ID: 978334779

View in Genome Browser
Species Human (GRCh38)
Location 4:107654767-107654789
Sequence AAACTCTGGATTGCGAAGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 508}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978334773_978334779 18 Left 978334773 4:107654726-107654748 CCCCACTGTCTGGCACAGCGCTC 0: 1
1: 0
2: 1
3: 36
4: 325
Right 978334779 4:107654767-107654789 AAACTCTGGATTGCGAAGAATGG 0: 1
1: 0
2: 0
3: 26
4: 508
978334775_978334779 16 Left 978334775 4:107654728-107654750 CCACTGTCTGGCACAGCGCTCCT 0: 1
1: 0
2: 0
3: 31
4: 266
Right 978334779 4:107654767-107654789 AAACTCTGGATTGCGAAGAATGG 0: 1
1: 0
2: 0
3: 26
4: 508
978334774_978334779 17 Left 978334774 4:107654727-107654749 CCCACTGTCTGGCACAGCGCTCC 0: 1
1: 0
2: 1
3: 17
4: 229
Right 978334779 4:107654767-107654789 AAACTCTGGATTGCGAAGAATGG 0: 1
1: 0
2: 0
3: 26
4: 508
978334776_978334779 -4 Left 978334776 4:107654748-107654770 CCTCTTTCCTGTGCTCAAAAAAC 0: 1
1: 0
2: 2
3: 36
4: 379
Right 978334779 4:107654767-107654789 AAACTCTGGATTGCGAAGAATGG 0: 1
1: 0
2: 0
3: 26
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978334779 Original CRISPR AAACTCTGGATTGCGAAGAA TGG Exonic
900840897 1:5047681-5047703 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
900847584 1:5115956-5115978 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
902128221 1:14235837-14235859 AGAGACTGGATTGCTAAGAAGGG - Intergenic
904996385 1:34634834-34634856 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
907503472 1:54900745-54900767 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
907521364 1:55025429-55025451 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
908461607 1:64352844-64352866 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
908591849 1:65644754-65644776 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
908852514 1:68389098-68389120 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
909222565 1:72982718-72982740 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
909223554 1:72990692-72990714 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
909512133 1:76465223-76465245 AAAATCTGGAATCAGAAGAAAGG - Intronic
909550927 1:76897650-76897672 AGGCTTTGGATTGGGAAGAAGGG + Intronic
909776583 1:79491444-79491466 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
909788168 1:79641607-79641629 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
909792889 1:79699240-79699262 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
909978346 1:82070393-82070415 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
911570493 1:99512453-99512475 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
912090707 1:106071853-106071875 AAAATCTGGATTGGGGAGATGGG - Intergenic
912347206 1:108975045-108975067 AAACACTGGATTGAGAAAAGTGG - Intronic
913488065 1:119352009-119352031 AAACAGTGGACTGCGAATAAGGG - Intergenic
915958713 1:160245807-160245829 AAACTCTAGATGGAGAAGATAGG - Intronic
916882332 1:169031919-169031941 AAACTATGGAAAGCAAAGAAAGG - Intergenic
916932002 1:169588005-169588027 GAACTCTGGACTGTAAAGAATGG - Intergenic
917061583 1:171047946-171047968 ATTCTCTGGATTACCAAGAAGGG + Intronic
918347221 1:183616481-183616503 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
918423775 1:184387772-184387794 AAGCTCTGGCTTGCAAAGTACGG - Intronic
918567566 1:185951176-185951198 AGGCTTTGGATTGGGAAGAAGGG + Intronic
918834444 1:189442874-189442896 AAACTTTGGATGGCGATAAAGGG + Intergenic
919463013 1:197901509-197901531 AAAATCTGGAAAGCGAAGGAGGG - Intergenic
920118419 1:203637642-203637664 AAAGTCTGGATTGGCAAGGAGGG - Intronic
920614618 1:207477969-207477991 TAACTCTGGAGTGTGAAGATGGG + Exonic
921156652 1:212444321-212444343 AAACTCTGTAGTGGGAAGGAAGG - Exonic
921212522 1:212912334-212912356 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
921459672 1:215412823-215412845 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
921520241 1:216148377-216148399 AGGCTTTGGATTGGGAAGAAGGG - Intronic
921732871 1:218596669-218596691 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
922153964 1:223027287-223027309 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
922364749 1:224853373-224853395 AAGCTCTGCATTGAAAAGAAGGG + Intergenic
922906496 1:229177253-229177275 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
923100855 1:230815655-230815677 TAAATCTGGATTGTGGAGAATGG + Intergenic
923214096 1:231833087-231833109 AGGCTTTGGATTGGGAAGAAGGG + Intronic
923244856 1:232121012-232121034 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
923408524 1:233686312-233686334 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
924180753 1:241436800-241436822 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1062846196 10:707707-707729 AAAGCCTGGATTGCTATGAATGG - Intergenic
1063363261 10:5473940-5473962 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1063509492 10:6632476-6632498 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1063527577 10:6799975-6799997 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1063773763 10:9236215-9236237 AAACTCTGGAATGGAAAGAAAGG + Intergenic
1064886898 10:20122043-20122065 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1064909334 10:20383397-20383419 AAAGTCTGTATTGCAAAGAATGG + Intergenic
1064980536 10:21162105-21162127 AAACTCTGGATACCAAAGATTGG + Intronic
1066800062 10:39177236-39177258 AAACTCTGGAATCCAAAGAAAGG - Intergenic
1067167468 10:43877257-43877279 AAACTCTGGAGTGGGAAGACTGG - Intergenic
1067280004 10:44864155-44864177 AAGCTCTGCTTTGCGAAGGAAGG - Intergenic
1068058245 10:52036646-52036668 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1068179554 10:53501913-53501935 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1068231077 10:54169585-54169607 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1068465182 10:57380725-57380747 AAAATCTGAATTAAGAAGAATGG + Intergenic
1068592238 10:58863896-58863918 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1070475032 10:76821402-76821424 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1070535753 10:77376060-77376082 TAACTCTGGATTTAGAAGATTGG - Intronic
1072580368 10:96735046-96735068 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1074722376 10:116273770-116273792 AAACTTTGTGTTCCGAAGAAGGG - Intergenic
1074740882 10:116483480-116483502 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1075248804 10:120847672-120847694 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1077637016 11:3849554-3849576 AAACTCTGCGGTGTGAAGAAAGG + Intergenic
1077850694 11:6072715-6072737 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1078046029 11:7915042-7915064 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1078194315 11:9122241-9122263 AAACTCAGAATTTCTAAGAAGGG - Intronic
1079447565 11:20570621-20570643 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1079847589 11:25490101-25490123 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1080027810 11:27631962-27631984 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1080572972 11:33573287-33573309 AAACTCTGAAGAGGGAAGAAGGG - Intronic
1080871022 11:36237125-36237147 ATACACTGGAATGTGAAGAATGG + Intergenic
1082584223 11:54914520-54914542 AAACTGTGGAATGAAAAGAAAGG + Intergenic
1082586172 11:54943715-54943737 AAACTGTTGATTGAAAAGAAAGG + Intergenic
1082593778 11:55048778-55048800 AAACTGCAGATTGCAAAGAAAGG + Intergenic
1084047265 11:66576446-66576468 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1084355655 11:68636536-68636558 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1086136163 11:83445780-83445802 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1087099738 11:94352478-94352500 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1087127913 11:94644436-94644458 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1087206664 11:95403847-95403869 AAACTCTGAATTGCCAGAAAAGG - Intergenic
1087314781 11:96590757-96590779 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1087839437 11:102906961-102906983 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1089349187 11:117812105-117812127 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1089470959 11:118719889-118719911 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1089729166 11:120510043-120510065 AAACTCTGAAATGCCAAGCATGG - Intergenic
1089987773 11:122829945-122829967 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1090107498 11:123868476-123868498 AGGCTTTGGATTGGGAAGAAAGG + Intergenic
1090546397 11:127771956-127771978 AAACTTTGGATTGGCAGGAAGGG + Intergenic
1090599202 11:128352900-128352922 AGACAATGGATTTCGAAGAAGGG - Intergenic
1090762663 11:129850839-129850861 AAAGCCTGGATTGCCATGAACGG - Intronic
1090850491 11:130567243-130567265 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1090871859 11:130756399-130756421 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1091183779 11:133629619-133629641 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1092626648 12:10335807-10335829 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1092723622 12:11465062-11465084 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1092739225 12:11612588-11612610 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1092851419 12:12631601-12631623 AAACTATGAATTGTGAAGAATGG + Intronic
1092924754 12:13262852-13262874 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1093071061 12:14707752-14707774 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1093267908 12:17024586-17024608 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1093358532 12:18197783-18197805 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1093584417 12:20819890-20819912 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1094400783 12:30058810-30058832 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1094825846 12:34268466-34268488 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1095637751 12:44452625-44452647 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1097416951 12:59326099-59326121 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1098173534 12:67769527-67769549 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1098629167 12:72706183-72706205 AGGCTTTGGATTGTGAAGAAGGG - Intergenic
1099087126 12:78259213-78259235 CAACTCTGACTTGAGAAGAAGGG + Intergenic
1099275338 12:80568933-80568955 AAACTCTGTTTTGAGAAGACAGG + Intronic
1099292000 12:80785962-80785984 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1100561467 12:95752006-95752028 AAGCTTTGGATTGGGAAGAAGGG - Intronic
1100940452 12:99718328-99718350 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1101217786 12:102602281-102602303 AAATTCTGAATTGAGAAAAAGGG - Intergenic
1101278294 12:103225558-103225580 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1101646964 12:106640292-106640314 AAGCTCATGCTTGCGAAGAAAGG + Intronic
1102158811 12:110752102-110752124 AATCTCTGGAGTGTGAAGAGGGG - Intergenic
1103192491 12:119013930-119013952 ATACCCTGGGTTGGGAAGAAGGG - Intronic
1105831877 13:24169758-24169780 AGACTCTAGACTGAGAAGAAAGG - Intronic
1106943542 13:34801467-34801489 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1106995086 13:35471504-35471526 GAATCCAGGATTGCGAAGAATGG + Intronic
1107075687 13:36319274-36319296 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1107220197 13:37972055-37972077 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1107683038 13:42870297-42870319 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1108202795 13:48059225-48059247 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1108803769 13:54130568-54130590 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1108814233 13:54269690-54269712 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1108913316 13:55581123-55581145 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1108919444 13:55657853-55657875 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1108947538 13:56043138-56043160 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1108952844 13:56115296-56115318 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1109343673 13:61091193-61091215 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1109353013 13:61207633-61207655 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1109709559 13:66144213-66144235 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1109716640 13:66229263-66229285 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1110765581 13:79276962-79276984 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1111125936 13:83911162-83911184 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1111368825 13:87289095-87289117 AAATTCTGTCTTGCAAAGAAAGG + Intergenic
1111458736 13:88515707-88515729 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1111631596 13:90851469-90851491 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1112236930 13:97645145-97645167 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1112415983 13:99203845-99203867 AAACTCTTCATTTTGAAGAAAGG + Intronic
1113318307 13:109207369-109207391 AAAATCTGTATTTTGAAGAAAGG - Exonic
1113324434 13:109268172-109268194 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1115904909 14:38193625-38193647 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1116179785 14:41518777-41518799 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1116490480 14:45498263-45498285 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1116702301 14:48258261-48258283 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1116953018 14:50896005-50896027 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1117194684 14:53327965-53327987 AGACTCTGGGTTGCCAAAAATGG + Intergenic
1117368916 14:55058039-55058061 GGACTCTGAATTGCCAAGAAAGG - Intronic
1117801286 14:59446912-59446934 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1117957815 14:61136301-61136323 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1119317304 14:73706328-73706350 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1120251298 14:82063965-82063987 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1120388839 14:83880256-83880278 TATCTTTGGATTGCCAAGAATGG + Intergenic
1120437958 14:84503095-84503117 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1121703749 14:95975782-95975804 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1123486496 15:20744693-20744715 AGACCCTGGATTGCCATGAATGG - Intergenic
1123542984 15:21313743-21313765 AGACCCTGGATTGCCATGAATGG - Intergenic
1125045876 15:35241604-35241626 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1125131412 15:36288519-36288541 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1126406063 15:48323899-48323921 AAACCCTGGATTACCAAGAAGGG - Intergenic
1128160360 15:65419746-65419768 AAATTCTGACTTGGGAAGAAGGG + Intronic
1130855210 15:87834099-87834121 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1130945843 15:88550379-88550401 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1131447847 15:92514340-92514362 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1131882408 15:96874702-96874724 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1132263118 15:100443121-100443143 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1132340519 15:101075370-101075392 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1133653967 16:7841598-7841620 AAAATATAGATTGTGAAGAATGG - Intergenic
1133704837 16:8343789-8343811 AAACTCAGGATTTCCATGAAGGG - Intergenic
1133765628 16:8835902-8835924 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1134342074 16:13355446-13355468 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1137957135 16:52843012-52843034 AAGCTCTGGCTTTGGAAGAATGG + Intergenic
1138805055 16:60081662-60081684 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1139225812 16:65232710-65232732 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1139942950 16:70619342-70619364 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1139943624 16:70623673-70623695 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1141213523 16:82002894-82002916 AAACTCTGGAGTGTGAAAAAAGG - Intronic
1144104770 17:11974720-11974742 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1146014201 17:29219456-29219478 AAACTCTGAATTGAGAAAAAAGG - Intergenic
1146521273 17:33527413-33527435 CAACTCTGGGCTGAGAAGAAAGG + Intronic
1147045769 17:37750966-37750988 AAACTCTGCATTTCGAAGGAAGG - Intergenic
1151435553 17:74094108-74094130 AAAGTCTAGATTGCCACGAATGG - Intergenic
1151839648 17:76608839-76608861 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1153663142 18:7343480-7343502 AGACTCTGGATTGAGAAGACAGG + Intergenic
1155173924 18:23286885-23286907 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1155693242 18:28652632-28652654 AACATCTGCATTGAGAAGAATGG + Intergenic
1155696920 18:28695993-28696015 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1158336479 18:56418425-56418447 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1159835155 18:73327471-73327493 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1163907286 19:20158368-20158390 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1164153075 19:22571075-22571097 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1164459123 19:28432743-28432765 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1165496909 19:36158302-36158324 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1165510226 19:36262371-36262393 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1165792648 19:38501148-38501170 AAACACTGAATTCCGATGAAGGG + Intronic
1165835458 19:38752441-38752463 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1166498837 19:43326386-43326408 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1167046507 19:47052635-47052657 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1168051740 19:53834433-53834455 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1168212026 19:54897763-54897785 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
925544655 2:5003813-5003835 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
925976409 2:9145198-9145220 AAACTCCGGATTGCAGAAAATGG - Intergenic
926407865 2:12572586-12572608 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
926413695 2:12629333-12629355 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
926710895 2:15879558-15879580 AAACTCTGAGGTGGGAAGAAAGG + Intergenic
926815441 2:16794816-16794838 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
927019436 2:19001443-19001465 AAACCCTGGATTGATAAGGAAGG - Intergenic
928827556 2:35439979-35440001 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
930341219 2:50117409-50117431 AAATTATGGATTGAGGAGAAGGG - Intronic
930955199 2:57195790-57195812 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
931026292 2:58116300-58116322 AGGCTTTGGATTGGGAAGAACGG + Intronic
931042715 2:58316525-58316547 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
931237038 2:60420435-60420457 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
931608839 2:64078059-64078081 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
931625882 2:64255364-64255386 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
931850518 2:66246757-66246779 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
931948358 2:67334432-67334454 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
932358716 2:71087922-71087944 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
932367543 2:71162565-71162587 AGGCTTTGGATTGGGAAGAAAGG + Intergenic
932630196 2:73335360-73335382 AAATTCTGGGTTGCCAAGCATGG - Intergenic
932719930 2:74131414-74131436 CCACTCTGGATTCCCAAGAAAGG + Intronic
932854108 2:75216651-75216673 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
932973848 2:76576728-76576750 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
933013191 2:77091202-77091224 AGGCTCTTGATTGGGAAGAAGGG - Intronic
933079370 2:77967935-77967957 AGGCTCTTGATTGGGAAGAAGGG - Intergenic
933163819 2:79054206-79054228 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
936560808 2:113538206-113538228 AAAGTGTGCATTGTGAAGAATGG + Intergenic
936883433 2:117281567-117281589 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
937317240 2:120939438-120939460 AAACTCTGAATCCCAAAGAATGG - Intronic
939307507 2:140428968-140428990 AGGCTTTGGATTGGGAAGAAGGG - Intronic
940530283 2:154870146-154870168 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
940675706 2:156722944-156722966 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
940883691 2:158970019-158970041 AAACTCTGGCTGGCGCGGAAAGG + Intronic
941353487 2:164461944-164461966 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
941889926 2:170569613-170569635 ACACTCTGGATGGCCAAGATGGG + Intronic
941935795 2:170980518-170980540 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
942730190 2:179054635-179054657 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
943412830 2:187563365-187563387 AGGCTTTGGATTGGGAAGAAGGG + Intronic
943951194 2:194133763-194133785 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
944387549 2:199182200-199182222 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
945938426 2:215925207-215925229 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
946214937 2:218176916-218176938 AAGCTTTGGATTGGGAAGAAGGG + Intergenic
946780944 2:223192715-223192737 AGGCTTTGGATTGGGAAGAAGGG + Intronic
946886597 2:224228121-224228143 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
946893375 2:224299506-224299528 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
948325597 2:237117679-237117701 AAACTCTGCATTGAAAAGCAGGG + Intergenic
948390792 2:237609781-237609803 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
948396037 2:237645818-237645840 AACATCTGGATTGCAGAGAAGGG + Intronic
1170068770 20:12343150-12343172 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1170106335 20:12756708-12756730 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1170165844 20:13359793-13359815 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1170325387 20:15150707-15150729 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1170820601 20:19754030-19754052 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1173102012 20:40096174-40096196 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1173118971 20:40271881-40271903 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1177100721 21:16894994-16895016 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1177102775 21:16916822-16916844 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1177303934 21:19288106-19288128 AAACTCTGTCTTGACAAGAATGG + Intergenic
1177358783 21:20042654-20042676 AAAAACTGGATTGCCAAAAAAGG - Intergenic
1178001293 21:28164034-28164056 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1178700208 21:34826926-34826948 AAAGCCTGCATTGCCAAGAACGG + Intronic
1179015180 21:37589887-37589909 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1179056810 21:37943988-37944010 AGACTATGGATTACGAGGAAAGG - Intergenic
1179365542 21:40755551-40755573 AAACTCTGGATTGGTAGGAGTGG + Intronic
1180561053 22:16614461-16614483 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1182647866 22:31825045-31825067 AAACTCTGGGTTCCTAAAAATGG - Intronic
1182732376 22:32505603-32505625 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1185235841 22:49712438-49712460 AAACTCTGGTTTGGGAAGGCTGG - Intergenic
949671256 3:6400510-6400532 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
950926596 3:16747147-16747169 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
952343475 3:32464297-32464319 AGGCTTTGGATTGGGAAGAAGGG + Intronic
952895953 3:38079155-38079177 AGGCTTTGGATTGGGAAGAAGGG + Intronic
953060048 3:39419820-39419842 AAACTCTGGATTGCTCAGGCTGG - Intergenic
953825606 3:46249188-46249210 AGGCTTTGGATTGGGAAGAAGGG + Intronic
954192623 3:48974829-48974851 AACATCTGCATTGAGAAGAATGG + Exonic
955141248 3:56272188-56272210 TTACTTTGAATTGCGAAGAAGGG - Intronic
956349649 3:68320760-68320782 AAACTCTAGATTGTGAAACAAGG + Intronic
956548898 3:70437741-70437763 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
956709314 3:72025823-72025845 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
957295338 3:78326637-78326659 AGGCTTTGGATTGGGAAGAAAGG - Intergenic
957317205 3:78586022-78586044 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
957527278 3:81393299-81393321 AAAACCTGGAATGGGAAGAAAGG + Intergenic
958052704 3:88368692-88368714 AAACTCTGGATTCCGAATCATGG - Intergenic
958182984 3:90083895-90083917 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
959972162 3:112420440-112420462 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
960221623 3:115118142-115118164 AATTTCTGGTTTGGGAAGAAAGG - Intronic
960282775 3:115796380-115796402 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
960310022 3:116108197-116108219 AGGCTTTGGATTGGGAAGAAGGG + Intronic
961730686 3:128962531-128962553 AGGCTTTGGATTGGGAAGAAGGG - Intronic
963520537 3:146356382-146356404 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
963663444 3:148154482-148154504 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
963684435 3:148417179-148417201 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
964067993 3:152600278-152600300 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
964125356 3:153229568-153229590 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
965262553 3:166503661-166503683 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
965335200 3:167425427-167425449 AGACTTTGGGTTGGGAAGAAGGG - Intergenic
965336427 3:167434050-167434072 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
966085526 3:176064170-176064192 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
966104995 3:176324508-176324530 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
967212063 3:187178408-187178430 AGGCTTTGGATTGTGAAGAAGGG + Intronic
967244077 3:187469151-187469173 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
967462951 3:189767489-189767511 AAAATCTGAATGGCCAAGAATGG + Intronic
967496325 3:190147335-190147357 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
967561486 3:190922941-190922963 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
967624549 3:191669363-191669385 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
969100320 4:4763577-4763599 AAGCTCTGAATTACGGAGAAAGG + Intergenic
970087640 4:12366597-12366619 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
971123085 4:23724903-23724925 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
971180656 4:24326040-24326062 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
971200235 4:24503842-24503864 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
972071034 4:35019659-35019681 AGGCTCTGGGTTGGGAAGAAGGG + Intergenic
972920574 4:43936313-43936335 AAACTCTGCATTTGGAAAAAGGG + Intergenic
973137935 4:46730224-46730246 AAACACAGGATTGCTAGGAAAGG - Intergenic
973953503 4:56040433-56040455 AAACTCAGGAATGAGAAGGAGGG + Intergenic
975864990 4:78716739-78716761 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
975933790 4:79556856-79556878 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
976696641 4:87924695-87924717 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
976884472 4:89967676-89967698 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
977012825 4:91657501-91657523 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
977075104 4:92441845-92441867 AGGCTTTGGATTGGGAAGAAGGG + Intronic
977198332 4:94087513-94087535 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
977217056 4:94296111-94296133 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
977236032 4:94508331-94508353 AAACTTAGGATTGTGAAAAAAGG + Intronic
978001018 4:103556642-103556664 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
978012082 4:103699905-103699927 AAACTCTGGATTACTGACAAGGG + Intronic
978334779 4:107654767-107654789 AAACTCTGGATTGCGAAGAATGG + Exonic
978438719 4:108711981-108712003 AGGCTTTGGATTGTGAAGAAGGG - Intergenic
979173352 4:117629658-117629680 AAAATATGGATTCCCAAGAAGGG - Intergenic
979380039 4:119996753-119996775 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
979850208 4:125564512-125564534 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
979895065 4:126148025-126148047 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
979897908 4:126183836-126183858 AAACTCTACACTGCTAAGAAAGG - Intergenic
980285038 4:130770193-130770215 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
980389027 4:132121027-132121049 AAGCTTTGGATTGGGAAGAAGGG - Intergenic
980472345 4:133266571-133266593 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
980527963 4:134014997-134015019 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
980904036 4:138930695-138930717 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
981539821 4:145835577-145835599 AGGCTTTGGATTGGGAAGAAGGG - Intronic
982083875 4:151815492-151815514 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
982180380 4:152744212-152744234 AGGCTTTGGATTGGGAAGAAGGG + Intronic
982535544 4:156603112-156603134 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
982939889 4:161537222-161537244 AAACACTGGATTCAGAAAAATGG + Intronic
983345657 4:166523354-166523376 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
983448148 4:167879083-167879105 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
983452432 4:167925721-167925743 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
984117631 4:175702015-175702037 AAAGTCTGGGTTGGGAAGGAAGG - Intronic
984322288 4:178209919-178209941 AAGTTTTGGATTGGGAAGAAGGG - Intergenic
984393515 4:179167773-179167795 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
985435812 4:189928685-189928707 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
985582447 5:705617-705639 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
986193627 5:5518374-5518396 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
986388978 5:7266415-7266437 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
986554949 5:9001425-9001447 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
987033553 5:13997627-13997649 AAAGTCTGCATTGCCATGAATGG - Intergenic
987486936 5:18536507-18536529 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
987487597 5:18541141-18541163 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
987498025 5:18671737-18671759 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
989830932 5:45917715-45917737 AAACTGTGGAATGAAAAGAAAGG + Intergenic
989846366 5:46148488-46148510 AAACTCTTGAATCCAAAGAAAGG - Intergenic
991655953 5:68903985-68904007 AAAGTCTGGATTGAGAAGAGGGG + Intergenic
992145167 5:73839648-73839670 AAACTCTGAATGGCAGAGAAAGG - Intronic
992394765 5:76360186-76360208 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
992960925 5:81956085-81956107 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
993192816 5:84701307-84701329 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
993836795 5:92826791-92826813 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
994532445 5:100987137-100987159 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
994989647 5:106981201-106981223 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
995122603 5:108552104-108552126 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
996745340 5:126842437-126842459 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
997746499 5:136304141-136304163 ATGCTTTGGATTGGGAAGAAGGG - Intronic
997769583 5:136542491-136542513 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
997772547 5:136568230-136568252 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
998996301 5:147871866-147871888 AGGCTTTGGATTGGGAAGAATGG + Intronic
999042071 5:148425614-148425636 GAAGTCTGGATTCCTAAGAACGG + Exonic
999421886 5:151451487-151451509 AAACTCTGGATTGTGAAGCCAGG - Intronic
999618767 5:153452588-153452610 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1000438680 5:161242799-161242821 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1000439817 5:161251324-161251346 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1000519313 5:162278279-162278301 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1003430077 6:6030671-6030693 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1004283422 6:14299836-14299858 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1004365806 6:15011606-15011628 AAACTCATGAATGCAAAGAAGGG + Intergenic
1004507895 6:16261872-16261894 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1004575323 6:16888779-16888801 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1004768474 6:18756949-18756971 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1004837103 6:19541734-19541756 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1005014555 6:21364386-21364408 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1007523311 6:42468363-42468385 AAAGCCTGGATTGCCATGAATGG - Intergenic
1008013175 6:46490709-46490731 AGCCTCTGCATTGGGAAGAAGGG + Intronic
1008519262 6:52347509-52347531 AAACTCTAGTTTGCAAGGAATGG + Intergenic
1009063615 6:58428317-58428339 AAACTCTTGAATGAAAAGAAAGG + Intergenic
1009251274 6:61302903-61302925 AAACTCTTGAATGAAAAGAAAGG + Intergenic
1009261938 6:61502394-61502416 AAACTGTTGATTGAAAAGAAAGG + Intergenic
1009897602 6:69772400-69772422 AAAATCTGGAGTGTGAAGGAAGG + Intronic
1010586595 6:77663434-77663456 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1010662410 6:78586216-78586238 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1010826761 6:80485005-80485027 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1010829596 6:80513185-80513207 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1010894447 6:81348026-81348048 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1011770839 6:90673091-90673113 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1011935259 6:92769283-92769305 AAACCCTGTATTGCCATGAATGG + Intergenic
1012066442 6:94556823-94556845 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1012315927 6:97782430-97782452 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1013407788 6:109858644-109858666 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1013891805 6:115034711-115034733 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1014360065 6:120465162-120465184 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1014454769 6:121623318-121623340 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1014555949 6:122842655-122842677 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1014612184 6:123559458-123559480 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1014614573 6:123585173-123585195 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1014718996 6:124894869-124894891 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1014793888 6:125704744-125704766 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1014891642 6:126851575-126851597 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1015269754 6:131326224-131326246 AAGCTTTGGATTGGGAAGAAAGG - Intergenic
1015271471 6:131341698-131341720 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1015287942 6:131507163-131507185 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1016204629 6:141455643-141455665 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1016248964 6:142018638-142018660 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1016535661 6:145106033-145106055 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1016853370 6:148642631-148642653 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1016968226 6:149738723-149738745 AATCTCAGGAGTTCGAAGAAAGG + Exonic
1017341304 6:153325457-153325479 AAACTCTGGAATGAGAACACAGG - Intergenic
1017389604 6:153924316-153924338 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1020532618 7:9356303-9356325 AGGCTTTGGATTGGGAAGAACGG + Intergenic
1020541047 7:9461441-9461463 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1021810758 7:24399098-24399120 AAGCTTTGGATTGGGAAGAAGGG - Intergenic
1021977796 7:26027076-26027098 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1022411814 7:30144755-30144777 AAACCCTGCAATGAGAAGAAAGG + Intronic
1022643390 7:32208718-32208740 AAAACCTGGATTCCAAAGAAGGG - Intronic
1022854647 7:34303000-34303022 AGGCTTTGGATTGGGAAGAAAGG + Intergenic
1023154661 7:37236711-37236733 AAACTCTCAGTTGCAAAGAAAGG + Intronic
1023698788 7:42873496-42873518 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1024242296 7:47445014-47445036 AACCTCTGTATTGGGAAGAGGGG + Intronic
1025595707 7:62922574-62922596 AAACTGTGGAATGAAAAGAAAGG - Intergenic
1025599217 7:62974067-62974089 AAACTGTGGAATCCAAAGAAAGG - Intergenic
1028233153 7:88329899-88329921 AAACTCTGGCTTGGTATGAAGGG - Intergenic
1028670606 7:93396762-93396784 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1030441585 7:109594905-109594927 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1031525693 7:122819753-122819775 AGGCTTTGGATTGGGAAGAAGGG - Intronic
1031685943 7:124731861-124731883 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1031776419 7:125912820-125912842 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1032730036 7:134631718-134631740 CAACTCTGGATACCCAAGAATGG + Intergenic
1033675847 7:143540105-143540127 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1033695987 7:143789338-143789360 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1033909370 7:146246265-146246287 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1034188130 7:149195081-149195103 TAAATCTGGATTGGGAAGAAGGG + Intergenic
1035880569 8:3241095-3241117 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1036281580 8:7405267-7405289 AGACTTTGGATTGGGAAGAAGGG - Intergenic
1036339890 8:7906305-7906327 AGACTTTGGATTGGGAAGAAGGG + Intergenic
1038719780 8:30024501-30024523 AAACTCAGGAATCAGAAGAAAGG + Intergenic
1042553639 8:70015960-70015982 GAACTATGGACTGCTAAGAAAGG + Intergenic
1042707472 8:71677741-71677763 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1044148419 8:88745094-88745116 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1044925262 8:97203746-97203768 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1045197626 8:99946701-99946723 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1045644882 8:104288763-104288785 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1046294216 8:112198654-112198676 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1046512182 8:115215056-115215078 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1047574258 8:126135669-126135691 AAACTCTTGTTTGTGAAGACAGG + Intergenic
1047699447 8:127434559-127434581 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1047747806 8:127857938-127857960 AAACTCTGGGTTGAGAAGAGAGG + Intergenic
1047829449 8:128614797-128614819 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1047864353 8:129005380-129005402 ATCCTCTGGATTGCAAAGAAAGG + Intergenic
1048143858 8:131822020-131822042 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1048168334 8:132083116-132083138 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1048303212 8:133266424-133266446 AAACTCACGCTTGAGAAGAAGGG + Intronic
1048728326 8:137411156-137411178 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1048764142 8:137827706-137827728 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1049868722 8:144957143-144957165 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1049891872 9:77120-77142 AAAGTGTGCATTGTGAAGAATGG - Intergenic
1050258007 9:3814048-3814070 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1051052727 9:12951153-12951175 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1051693873 9:19747238-19747260 AAACTCAGGATGGTGAGGAAAGG - Intronic
1051849181 9:21488584-21488606 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1053733297 9:41078211-41078233 AAAGTGTGCATTGTGAAGAATGG - Intergenic
1054361237 9:64122527-64122549 AGAATCTGGAGTGGGAAGAAGGG + Intergenic
1054695122 9:68353352-68353374 AAAGTGTGCATTGTGAAGAATGG + Intronic
1054807390 9:69407631-69407653 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1055233169 9:74088491-74088513 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1055626822 9:78183639-78183661 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1055881840 9:81011839-81011861 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1056061254 9:82886577-82886599 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1056323988 9:85461474-85461496 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1056522549 9:87413754-87413776 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1056883077 9:90415404-90415426 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1057234948 9:93350437-93350459 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1057378087 9:94542646-94542668 AGACTTTGGATTGGGAAGAAGGG - Intergenic
1057684095 9:97217663-97217685 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1058565766 9:106283484-106283506 TAACTCTGGATTCTGAAGGAGGG + Intergenic
1059863389 9:118488550-118488572 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1185858329 X:3556012-3556034 AGGCTCTGGATTGGGAAGAAGGG + Intergenic
1185991158 X:4894414-4894436 AGGCTCTGGATTGGGAAGAAGGG - Intergenic
1187086428 X:16047570-16047592 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1187727220 X:22215761-22215783 AACCTCTGCATTTCGAAGGATGG - Intronic
1188052707 X:25507371-25507393 AAGCACAGGATTGAGAAGAATGG + Intergenic
1188102903 X:26112659-26112681 CCACTCTGGATTGAGAACAAGGG - Intergenic
1188431123 X:30106176-30106198 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1188463285 X:30451981-30452003 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1191268390 X:58428412-58428434 AAACTCTTGAATGAAAAGAAAGG + Intergenic
1192729199 X:73785631-73785653 AAACTCTGGAGAGGGAAGAGAGG - Intergenic
1193941597 X:87684722-87684744 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1194186153 X:90776205-90776227 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1194308446 X:92275947-92275969 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1194351385 X:92827322-92827344 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1194367202 X:93025761-93025783 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1194502884 X:94701703-94701725 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1195608096 X:106832586-106832608 AAACTATGGAATGTCAAGAAAGG + Intronic
1195908581 X:109868105-109868127 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1196073184 X:111546751-111546773 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1196165645 X:112533443-112533465 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1196300107 X:114042815-114042837 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1196330922 X:114469591-114469613 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1196341616 X:114604180-114604202 AGGCTTTGGATTGGGAAGAAGGG + Intronic
1196470005 X:116013504-116013526 AGACTTTGGATTAGGAAGAAGGG - Intergenic
1196533449 X:116815366-116815388 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1196572599 X:117281982-117282004 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1196773765 X:119320659-119320681 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1196936897 X:120739292-120739314 AAACTCTGGAGTAGGAAAAAGGG + Intergenic
1197065016 X:122224864-122224886 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1197351957 X:125391726-125391748 AGGCTTTGGATTGGGAAGAAGGG + Intergenic
1198039366 X:132834821-132834843 AAACTCTTCATTGTTAAGAAGGG - Intronic
1199576573 X:149318489-149318511 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1200532746 Y:4358285-4358307 ATGCTTTGGATTGGGAAGAAGGG + Intergenic
1200659707 Y:5944014-5944036 AGGCTTTGGATTGGGAAGAAGGG - Intergenic
1200675416 Y:6142018-6142040 AGGCTTTGGATTGGGAAGAAGGG - Intergenic