ID: 978335412

View in Genome Browser
Species Human (GRCh38)
Location 4:107662621-107662643
Sequence TATATCTCATGCTAGATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978335412 Original CRISPR TATATCTCATGCTAGATTTA AGG (reversed) Intronic
900082769 1:871082-871104 TATTTCTATTGCTAGATTTCTGG + Intergenic
900466365 1:2827395-2827417 TATATCCCATGCACGATTTGGGG + Intergenic
901112863 1:6812797-6812819 AATATATCAAGCCAGATTTATGG - Intronic
901892614 1:12280452-12280474 TACATCACATGCTAGATTTAAGG - Intronic
904889921 1:33772084-33772106 TTTATCTCATATTGGATTTAGGG - Intronic
907606415 1:55822225-55822247 TAAATTTCAGACTAGATTTAGGG - Intergenic
910265590 1:85333894-85333916 TAAATCTCTTGCTAGACTTAGGG - Intronic
910294162 1:85627959-85627981 TATTCCTCATGGCAGATTTAAGG + Intergenic
911819011 1:102392404-102392426 TATATCTCAATATAGATATATGG - Intergenic
913708833 1:121458375-121458397 TATATCTACTACTAAATTTAAGG - Intergenic
917018325 1:170559568-170559590 TATGTCCCAGGCTAGATTTCAGG - Intergenic
918797591 1:188922869-188922891 TATATTTCATGCAAAATTGAAGG - Intergenic
919477588 1:198048292-198048314 TAAATCTCTTGCTAGACTTGGGG + Intergenic
921280898 1:213567276-213567298 TATATTTCATCCTACATCTAAGG + Intergenic
921800965 1:219401431-219401453 TGTATCTCTTGATAGATGTATGG - Intergenic
922673795 1:227537549-227537571 TATTTCTATTGCTAGATTTCTGG - Intergenic
924156792 1:241185069-241185091 TATATTTCATGGATGATTTAAGG - Intronic
924304260 1:242671161-242671183 TGTTTCTCATGGTAGATTTATGG - Intergenic
1062760683 10:15058-15080 TATTTCTATTGCTAGATTTCTGG + Intergenic
1063660251 10:8030752-8030774 TATATATCATCCTAGATAAAGGG - Intergenic
1064494574 10:15895591-15895613 TATACCTCATGCAAAATGTAAGG + Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066654969 10:37688583-37688605 TATGTCTTTTGCCAGATTTAGGG - Intergenic
1077848938 11:6055575-6055597 TATCTTTCATGCTAGATTGTAGG - Intergenic
1077935457 11:6780636-6780658 TATATATCATTCTATATTTGTGG + Intergenic
1085339269 11:75720701-75720723 TATACCACATGCCAGAGTTAGGG - Intronic
1086568098 11:88249713-88249735 TAAATGTCATGGTAGATGTAGGG + Intergenic
1087150111 11:94851831-94851853 TATATGCCTTGCTAGAATTAAGG + Intronic
1088674209 11:112175903-112175925 TATATTTTATGCAATATTTAAGG + Intronic
1090800368 11:130167574-130167596 CATACCTCATGCTAGATTTGTGG + Intronic
1094157685 12:27354558-27354580 TAAATCTCATTTTAGGTTTAAGG - Intronic
1094270952 12:28613751-28613773 TATGTATCAAGTTAGATTTAAGG + Intergenic
1094808412 12:34112751-34112773 TATTTCTATTGCTAGATTTCTGG + Intergenic
1095666669 12:44810004-44810026 AATTCCTCATGCTAGAGTTAAGG + Intronic
1097497602 12:60360610-60360632 TATATGTTATAATAGATTTAGGG - Intergenic
1098061076 12:66563496-66563518 TAAATATTTTGCTAGATTTATGG + Intronic
1101056582 12:100923035-100923057 TTTATCTCATGTTGGATTTGAGG + Intronic
1105309300 13:19192057-19192079 TATATCTTTTGCTAAATTTGGGG - Intergenic
1108909684 13:55530513-55530535 TAAATATAATGCTACATTTATGG + Intergenic
1109348650 13:61146851-61146873 TTTATTTCCTGCTAGATTGATGG + Intergenic
1109401714 13:61839697-61839719 TATTTTTCATGCTAGTTTAAAGG - Intergenic
1110408822 13:75181835-75181857 TATATCTGATGATAGAATTATGG - Intergenic
1110422088 13:75322827-75322849 TATATCTTATACTAGTTTTGTGG + Intronic
1110997133 13:82124515-82124537 TATATATTATGCTAAATTCAAGG + Intergenic
1111116678 13:83787446-83787468 GATATCTAATGCATGATTTAAGG - Intergenic
1111397900 13:87691400-87691422 TAAATCTTATGTTAGCTTTAAGG + Exonic
1112167880 13:96939069-96939091 TATTTTTCATGCTAGATGGAAGG + Intergenic
1112658744 13:101482577-101482599 TAAATTTCATGGTATATTTAGGG - Intronic
1113002510 13:105658574-105658596 TTTAGCTCATGCTAGTTTTCTGG + Intergenic
1113068009 13:106391300-106391322 TTTATTTTATTCTAGATTTAAGG + Intergenic
1113249511 13:108436504-108436526 TATATCTAATGCTAAATGAAGGG - Intergenic
1114030920 14:18580260-18580282 TATTTCTATTGCTAGATTTCTGG - Intergenic
1114705078 14:24716817-24716839 TATATCTAAAGCTGTATTTAGGG + Intergenic
1114933372 14:27503961-27503983 CATGTCTTATGCTAGATTTGGGG + Intergenic
1115279508 14:31645916-31645938 TCTATCTAATGCTATAATTATGG - Intronic
1117643896 14:57830529-57830551 TCTTTCTCATGCTAGACTTCAGG - Intronic
1117650101 14:57895425-57895447 CAAATCTCATGCTAAATTGAAGG + Intronic
1119550940 14:75513717-75513739 AATATCTCAGGCTGGATATACGG - Intergenic
1119660189 14:76445624-76445646 AAGATGTCATGATAGATTTAGGG + Intronic
1120751967 14:88205938-88205960 TTTATCTCTTGCTAGATGAATGG - Intronic
1122390838 14:101382105-101382127 TATATCCTATGCTAGGATTAGGG + Intergenic
1123226248 15:17035671-17035693 TATATCTAATGCTAGATGACGGG - Intergenic
1131344028 15:91629609-91629631 TATATCCCATGCAATATTTTGGG - Intergenic
1131658462 15:94486526-94486548 TAAATCTCTTCCTAGACTTAGGG - Intergenic
1134852232 16:17489133-17489155 TATATGTCATGATAAATTTTAGG - Intergenic
1138696828 16:58821708-58821730 TATATCTTATTTTAGATTTGGGG + Intergenic
1138738782 16:59282337-59282359 TAAATCTCTTGCTAGACTTGGGG - Intergenic
1139062429 16:63269417-63269439 TATATTTCTTGCTAGATTTGGGG - Intergenic
1140267131 16:73430311-73430333 TATGTCTGATGCAATATTTAGGG - Intergenic
1143457832 17:7079122-7079144 TGTATCTCATGCTAGGATTGGGG + Intronic
1145395857 17:22494267-22494289 TTGATCTCATGCTAGATCTTAGG + Intergenic
1148915255 17:50971396-50971418 TATATCTCATATTGGATTTGGGG - Intronic
1150563301 17:66314316-66314338 GAAATCTCATGCTAAACTTAAGG + Intronic
1152953590 18:15412-15434 TATTTCTATTGCTAGATTTCTGG + Intergenic
1157893278 18:51439413-51439435 TTTATCTCATGCTTGGTTCAAGG + Intergenic
1159546375 18:69843835-69843857 TCTATCTCATGGTACATTTTTGG + Exonic
1163199099 19:15749779-15749801 TTTACCTTATGCTAGATTTCTGG + Intergenic
1164092009 19:21963257-21963279 TTTATCTCATCCAAGCTTTATGG + Intronic
1164196167 19:22962622-22962644 TTTATCTCATTCAAGTTTTAAGG + Intergenic
1167790864 19:51679114-51679136 TATTTCTCATCCAAGATTTCAGG - Intergenic
926471784 2:13269166-13269188 TTTATCTCAGGCTACCTTTAGGG + Intergenic
930132242 2:47863979-47864001 TAAATCTAAAGCTGGATTTAGGG + Intronic
932927388 2:75992767-75992789 TAAATCTCTTGCTAGATTTGGGG + Intergenic
933588913 2:84209973-84209995 TTTATCTCATTCTAGATCTATGG + Intergenic
935556625 2:104517012-104517034 TATATGGCTTGCTAGTTTTAAGG + Intergenic
937054363 2:118920179-118920201 AATATCACATGGTAGGTTTATGG - Intergenic
937517762 2:122674645-122674667 TATGTCTCATGCTATATTTAGGG - Intergenic
938497283 2:131805514-131805536 TATTTCTATTGCTAGATTTCTGG + Intergenic
942009728 2:171748539-171748561 TATACCACATGGTATATTTAGGG - Intergenic
942919063 2:181348832-181348854 TATCTGCCATGCTAAATTTAAGG + Intergenic
943489905 2:188538207-188538229 TATATCTTCTGCTAGCTTTGGGG + Intronic
1169960677 20:11156391-11156413 TAAATCTCATGGTAGATTTAGGG + Intergenic
1170262185 20:14422605-14422627 TATATAACATTCTAAATTTATGG + Intronic
1170960239 20:21019270-21019292 TATATCTAATGAGATATTTAGGG + Intergenic
1172585944 20:36084698-36084720 AATAACTCATCCTGGATTTAGGG - Intergenic
1173888839 20:46486999-46487021 TATATTTCATGTTATATATAAGG + Intergenic
1177661854 21:24094726-24094748 TCTACCACTTGCTAGATTTATGG + Intergenic
1180400103 22:12409266-12409288 TATATCTAATGCTAGATGACGGG - Intergenic
1180455033 22:15507318-15507340 TATTTCTATTGCTAGATTTCTGG - Intergenic
1183577227 22:38699896-38699918 TGTTTCTCATGGTAGATTTGTGG + Exonic
954517905 3:51196440-51196462 TAAATCTCTTGCTAGACTTGAGG + Intronic
954526382 3:51275419-51275441 TATATTTCTGGGTAGATTTATGG - Intronic
955150492 3:56362116-56362138 TATATCTCCTGCTAAATGAAAGG + Intronic
957781741 3:84827162-84827184 TAAAACTTTTGCTAGATTTAGGG + Intergenic
959340941 3:105129925-105129947 TATTTCTCCTGCTAGCTTTGGGG + Intergenic
959737956 3:109682578-109682600 TCTTGCTCATGCTAGATTAAAGG - Intergenic
960505169 3:118484574-118484596 TTTATCTCATTCTTGATTAAAGG + Intergenic
962143346 3:132813785-132813807 TCTATCTCTAGCTACATTTATGG + Intergenic
965078988 3:164014464-164014486 TTTTTCTCATTCTAGATTGATGG - Intergenic
965185611 3:165458866-165458888 TGTATCCCATGCTAGGTCTAAGG - Intergenic
965884778 3:173431787-173431809 CATATATCATGATACATTTATGG - Intronic
966005064 3:175000815-175000837 TACCTCTCATGGTAGTTTTAAGG - Intronic
966048590 3:175585361-175585383 TTTATCTTCTGCTAGATTCATGG + Intronic
966467637 3:180249106-180249128 TATATATGATCCTAGATTTTTGG - Intergenic
967665058 3:192161338-192161360 TATTTCTCATGGAAGAATTAAGG - Intronic
968865190 4:3205109-3205131 AATATGTGATGCTAGTTTTATGG - Intronic
971705827 4:30041469-30041491 TCTATCTCTTGGTATATTTAAGG - Intergenic
971769339 4:30876555-30876577 AATATCACATGCAAGTTTTATGG + Intronic
973197723 4:47464233-47464255 TATATCCCATACAATATTTAGGG - Intergenic
976016825 4:80565708-80565730 TATATCTCATTATGGATGTATGG - Intronic
976263814 4:83171638-83171660 TATGTCACATGCAATATTTAAGG + Intergenic
977470093 4:97432362-97432384 TAAATCCCATGCCAAATTTAGGG + Intronic
978335412 4:107662621-107662643 TATATCTCATGCTAGATTTAAGG - Intronic
978827371 4:113041574-113041596 TATATAACATCCTAGTTTTAGGG + Intronic
980274499 4:130632209-130632231 TACATCTAAGACTAGATTTATGG - Intergenic
982929888 4:161391508-161391530 GATAGCTCATGTCAGATTTATGG - Intronic
983626435 4:169806197-169806219 TATGTTTTATGCTAGAATTAGGG + Intergenic
983631364 4:169852820-169852842 TATATCTCCTGAAAGATTGAGGG - Intergenic
984007441 4:174329776-174329798 TCTTTCTCAAGATAGATTTATGG + Intronic
985005150 4:185527275-185527297 TATTTCTAATGCTTTATTTAGGG + Intronic
986943369 5:12984567-12984589 TATATCTCATGTTAACTTTCAGG + Intergenic
988900483 5:35727101-35727123 TATATTTCTTGCTACAGTTAGGG - Intronic
989202023 5:38773175-38773197 TATTTCTCATGCAATATTTGGGG - Intergenic
989490408 5:42046310-42046332 TATACAACATGCTAGATCTAAGG - Intergenic
989788748 5:45365195-45365217 TATTTTTCATGTTAGATTTAGGG + Intronic
989969255 5:50502158-50502180 TATATCTAATACTAAATTTAAGG + Intergenic
989994223 5:50808518-50808540 TATGTCTCCTGAAAGATTTAGGG + Intronic
991347790 5:65688231-65688253 TATATCTCATGCTCCGTTTCTGG - Intronic
994821313 5:104654152-104654174 TAAGTCTCTTGCTAGATTTGGGG - Intergenic
995999176 5:118337986-118338008 TATATCAAATGGTAGTTTTAAGG - Intergenic
998533128 5:142903441-142903463 TTTATCTCATTTTAGATCTAAGG + Intronic
998607790 5:143653164-143653186 TATATCTACTGCTTGATTTTAGG - Intergenic
1000744387 5:165014345-165014367 TATTTCTGATACTAGATTTTGGG + Intergenic
1002685455 5:181005798-181005820 TACATCGCATGCTGGATATAGGG - Exonic
1004027451 6:11833029-11833051 TATTTTTAATGCTAGTTTTAAGG + Intergenic
1012468621 6:99544382-99544404 TATATAACAAGATAGATTTATGG - Intronic
1014880629 6:126719824-126719846 TATTTCTCATGATAGAATAATGG + Intergenic
1015199813 6:130566596-130566618 TATATCTTTTGCCAGATTTGAGG - Intergenic
1016684434 6:146865193-146865215 TATGCCTCATGCTAAATTTGGGG - Intergenic
1018871432 6:167786160-167786182 CATATCTTATGCCAGATTAAAGG - Intronic
1021010444 7:15457787-15457809 TAGATCTCATGGTAGGTGTAAGG - Intronic
1021138074 7:16990498-16990520 TATATTGGATTCTAGATTTAAGG + Intergenic
1024016653 7:45322871-45322893 TATATCTTTTGCCAAATTTAGGG + Intergenic
1024081326 7:45858411-45858433 TAGATCTCATGCAAGAATTCAGG + Intergenic
1026838020 7:73650988-73651010 TATGTCTCATGCCATATTTGTGG + Intergenic
1030378687 7:108785672-108785694 TATGTCTCCTGGAAGATTTAAGG + Intergenic
1034652924 7:152706400-152706422 TATATGTAATGTTACATTTAGGG - Intergenic
1037728540 8:21504512-21504534 AATATCTCAGGCTAGTTTTCGGG - Intergenic
1038097872 8:24335900-24335922 TATATCCCATGCAATATTTGAGG + Intronic
1038702185 8:29859147-29859169 TATATCCCATGCAATATTTGGGG - Intergenic
1041864838 8:62560298-62560320 TATTTCTCTTGCTAAATTTGGGG + Intronic
1042843674 8:73149195-73149217 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843680 8:73149243-73149265 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843686 8:73149291-73149313 TATATATGATTGTAGATTTAGGG - Intergenic
1042843691 8:73149339-73149361 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843697 8:73149387-73149409 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843714 8:73149531-73149553 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843720 8:73149579-73149601 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843726 8:73149627-73149649 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843732 8:73149675-73149697 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843738 8:73149723-73149745 TATATTTGATTATAGATTTAGGG - Intergenic
1042843744 8:73149771-73149793 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843749 8:73149819-73149841 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843755 8:73149867-73149889 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843761 8:73149915-73149937 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843767 8:73149963-73149985 TATATTTGATTATAGATTTAGGG - Intergenic
1042843773 8:73150011-73150033 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843779 8:73150059-73150081 TATATTTGATTATAGATTTAGGG - Intergenic
1042843785 8:73150107-73150129 TATATTTGATTATAGATTTAGGG - Intergenic
1043082289 8:75782008-75782030 AATATCAAATGCTAGTTTTAAGG - Intergenic
1044478033 8:92651464-92651486 TCAATCTAATGCTAGATTTATGG - Intergenic
1045409191 8:101899100-101899122 TATATCTAATGAAACATTTATGG - Intronic
1045799970 8:106090707-106090729 TATATGCTATGTTAGATTTAAGG + Intergenic
1046068982 8:109227473-109227495 TATTTCTCATCCCAGATTTTGGG - Intergenic
1046330290 8:112705544-112705566 GATATCTCATGTCAGATTAACGG - Intronic
1047063615 8:121255299-121255321 TATGTCTCTTTCTACATTTAAGG - Intergenic
1047383595 8:124387325-124387347 TATATCTCATGCTTCATATCAGG + Intergenic
1048786630 8:138057433-138057455 TATCTCTCCAGCTAGATTTCAGG + Intergenic
1050684803 9:8156094-8156116 AATATGTCATTTTAGATTTATGG - Intergenic
1051091563 9:13415655-13415677 TTTTTCTCATGCTACATATAAGG - Intergenic
1051951144 9:22634865-22634887 CTTATCTCCTGATAGATTTAGGG - Intergenic
1052562401 9:30102748-30102770 TATATATCAAGATAGATCTAAGG - Intergenic
1053174369 9:35911598-35911620 TAAATGCCATGCTATATTTAAGG + Intergenic
1053596178 9:39563859-39563881 TATCTCTCAATCTTGATTTAGGG + Intergenic
1053854146 9:42320500-42320522 TATCTCTCAATCTTGATTTAGGG + Intergenic
1054570078 9:66801158-66801180 TATCTCTCAATCTTGATTTAGGG - Intergenic
1188332144 X:28887415-28887437 TATTTATCATGCAATATTTAAGG + Intronic
1188572877 X:31610644-31610666 TATGTCTCAGTCTTGATTTAGGG - Intronic
1190517348 X:51237363-51237385 TATATCTCTTGTAAGATTTGGGG - Intergenic
1191095903 X:56672660-56672682 TATAGCTCAGGTTTGATTTACGG - Intergenic
1192793939 X:74411339-74411361 GATACCTGATTCTAGATTTAAGG + Intergenic
1193575390 X:83189188-83189210 TATTTCTCCTGCTAGCTTTGTGG + Intergenic
1196305739 X:114100778-114100800 TATCTCTCATGCTATTTTTGAGG - Intergenic
1198160725 X:134005249-134005271 CATATCTCATGCCAGTTTAAAGG + Intergenic
1198573039 X:137978597-137978619 TATATATTATGCTAGATGTTAGG - Intergenic
1199176616 X:144795265-144795287 CTTATCTCATGCTTGTTTTATGG - Intergenic
1200563688 Y:4738173-4738195 TATATATCCTGATAGACTTAGGG - Intergenic