ID: 978336933

View in Genome Browser
Species Human (GRCh38)
Location 4:107679207-107679229
Sequence GTGGCTTATCACTTGGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978336933_978336937 8 Left 978336933 4:107679207-107679229 CCTAGCACCAAGTGATAAGCCAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 978336937 4:107679238-107679260 GCTGCTGAGAGACAAGCAGGAGG 0: 1
1: 0
2: 3
3: 44
4: 357
978336933_978336939 30 Left 978336933 4:107679207-107679229 CCTAGCACCAAGTGATAAGCCAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 978336939 4:107679260-107679282 GAAGACTCCTTCTGTGGTACAGG 0: 1
1: 0
2: 0
3: 13
4: 164
978336933_978336938 24 Left 978336933 4:107679207-107679229 CCTAGCACCAAGTGATAAGCCAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 978336938 4:107679254-107679276 CAGGAGGAAGACTCCTTCTGTGG 0: 1
1: 0
2: 0
3: 36
4: 279
978336933_978336936 5 Left 978336933 4:107679207-107679229 CCTAGCACCAAGTGATAAGCCAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 978336936 4:107679235-107679257 TATGCTGCTGAGAGACAAGCAGG 0: 1
1: 0
2: 2
3: 33
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978336933 Original CRISPR GTGGCTTATCACTTGGTGCT AGG (reversed) Intronic
901157211 1:7148908-7148930 CTGGCTTATCACCAGGTCCTGGG + Intronic
905642283 1:39598797-39598819 GTGGCTGATTAATGGGTGCTGGG + Intergenic
908460352 1:64342828-64342850 GTGGGTTATGACCTGGTGCCAGG + Intergenic
909575805 1:77174661-77174683 GTGTCTTATCTCTTAGTGGTGGG - Intronic
911293533 1:96085743-96085765 GTGTTTTCTCACTTGGTGATTGG - Intergenic
912924029 1:113897361-113897383 GTGGGTGATCACTTGAGGCTAGG + Intronic
913108005 1:115632598-115632620 GTGGCTTTTCAACTGGGGCTTGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915268755 1:154737043-154737065 CTGGCTCATCACTTCCTGCTTGG - Intronic
916116950 1:161493437-161493459 GTGTCTTATCATTTGCAGCTTGG + Intergenic
918280592 1:183001045-183001067 GTGTTTTGTCACTAGGTGCTTGG + Intergenic
920287874 1:204894310-204894332 ATGTCTTATCCCTTGGAGCTGGG + Intronic
922781999 1:228259998-228260020 GTGGGTTCTGACTGGGTGCTGGG - Intronic
922795191 1:228336309-228336331 GTGGCTGATCCCCTGATGCTTGG + Intronic
923043664 1:230338348-230338370 GTGGGTTCTCATCTGGTGCTTGG + Intronic
923806814 1:237266579-237266601 GTGGCTTGTGAATTGGTGTTTGG + Intronic
924656876 1:245980403-245980425 GTGGCCTCTTACCTGGTGCTGGG - Intronic
924744094 1:246816529-246816551 GGGGCATATCACTTGAGGCTAGG - Intergenic
1068535863 10:58241010-58241032 ATGGCTTGTCACTTGTTTCTTGG - Intronic
1070692177 10:78535117-78535139 GTTGGTTATCACATGGTGTTAGG - Intergenic
1071371747 10:84958258-84958280 CTGGAGTATCACTTGGTGTTTGG + Intergenic
1071964803 10:90841770-90841792 TTGGCTGATCACTTGAAGCTAGG + Intronic
1077971484 11:7196592-7196614 GTGGCTTAGCACTTGCTGGAGGG - Intergenic
1078334965 11:10455989-10456011 GTGGCTTATCTCCTGCAGCTGGG + Intronic
1079015229 11:16863116-16863138 GCGGGGTATCACTTGCTGCTAGG - Intronic
1079379722 11:19927193-19927215 GTGGTTTGTCAGTTGGTGGTGGG + Intronic
1079587258 11:22141334-22141356 GTAGCATATTGCTTGGTGCTTGG - Intergenic
1084962163 11:72722586-72722608 GAGGCTGATCACTTGTTGCCAGG - Intronic
1093870506 12:24285164-24285186 GTGGCTTCTGACTTCCTGCTTGG + Intergenic
1098417051 12:70245706-70245728 GTGGCTTATCTTCTGATGCTGGG + Intronic
1104149331 12:126067253-126067275 GTTGCCAATCACTGGGTGCTGGG - Intergenic
1109910454 13:68904604-68904626 ATTGCTTCTCACTTGGTCCTTGG + Intergenic
1110089763 13:71431303-71431325 GTGACTTTTCCATTGGTGCTTGG - Intergenic
1112217519 13:97448797-97448819 GAGTTTTATTACTTGGTGCTAGG + Intronic
1117951643 14:61089214-61089236 GTTGCTTGTTACTTAGTGCTGGG + Intergenic
1118951827 14:70442194-70442216 GGGGCTGACTACTTGGTGCTAGG + Intergenic
1119142709 14:72282287-72282309 AACGCTTATCACTTGGTACTTGG - Intronic
1122447497 14:101780737-101780759 GTGGCATATCACTTAGTCCTTGG + Intronic
1125813387 15:42562365-42562387 GTGGCTGATCACTTGAGGCCAGG + Intronic
1134235489 16:12462121-12462143 GTGGCTTCGCTCTGGGTGCTGGG + Intronic
1134754136 16:16651326-16651348 TTGGCTTCTCATTTGGTGCAAGG - Intergenic
1139618473 16:68116300-68116322 GTGGCCTACCACTTGTTGGTGGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140828672 16:78730808-78730830 GTGGCTTATCACTTGGAATGTGG + Intronic
1141252436 16:82370542-82370564 CTGGATGATCACTTTGTGCTGGG + Intergenic
1145217428 17:21062319-21062341 GTGGCTGTTCACTAGGTGCTGGG + Intergenic
1146093956 17:29909829-29909851 GTACCTTATCACTTGTTGCTAGG - Intronic
1155271729 18:24148347-24148369 GTGGTTTATCACCTGGGGCTGGG + Intronic
1157688682 18:49663662-49663684 GTGGGTCTGCACTTGGTGCTGGG + Intergenic
1160657162 19:279412-279434 GTGTCTGCTCTCTTGGTGCTGGG + Intergenic
1163802215 19:19373216-19373238 GTGGCTGATCACTTGGGCCTGGG - Intergenic
1164108828 19:22135631-22135653 GAGTCATATCACTAGGTGCTGGG - Intergenic
1165475325 19:36026919-36026941 GGGGCTTATGACTTGGGGGTAGG + Intronic
1166272678 19:41726411-41726433 GTGGGTTTTCATTTGGGGCTTGG - Intronic
1166745425 19:45139805-45139827 GTGGGTTCTGACTGGGTGCTGGG + Intronic
1168369606 19:55821303-55821325 GTTTTTTATCACTTGCTGCTGGG + Intronic
927714685 2:25343670-25343692 GTAGCCCAGCACTTGGTGCTAGG + Intergenic
930942355 2:57028123-57028145 CTGGATTCTCCCTTGGTGCTGGG - Intergenic
937511501 2:122600127-122600149 GGGGCTTATTAGTTGGTTCTAGG - Intergenic
938892573 2:135720402-135720424 GAGGGTTATCAGTAGGTGCTAGG - Intronic
939490930 2:142875353-142875375 CTGGCATTTCACTTTGTGCTTGG + Intergenic
941542908 2:166808895-166808917 GTGCCTTACCTCTTGTTGCTAGG - Intergenic
942311496 2:174661097-174661119 ATAGCTGATCAGTTGGTGCTGGG + Intronic
1170036693 20:11997139-11997161 TTTCCTTAGCACTTGGTGCTTGG + Intergenic
1174817940 20:53702708-53702730 CTGGCGGATCACTTGATGCTAGG + Intergenic
1175177800 20:57123773-57123795 GTGGCTTAACACTGAATGCTGGG + Intergenic
1175567600 20:59993070-59993092 GTGATATATCACTTGGAGCTTGG - Intronic
1176952233 21:15062153-15062175 GTGGCTTATCACATTGTCCATGG - Intronic
1179924611 21:44527597-44527619 GTGGCTTGTGACTTGGGGCTTGG - Intronic
1182304240 22:29356843-29356865 GTGGCTAAGCCCTTGGAGCTAGG - Intronic
1183370385 22:37428399-37428421 GGGGCCTATAACTTGGTGCTTGG + Intergenic
949573965 3:5320750-5320772 ATGGCTGACAACTTGGTGCTGGG + Intergenic
952619005 3:35313526-35313548 ATGGCTGTTCACTTGGTGTTTGG - Intergenic
955757814 3:62243413-62243435 GTGGTTTTGAACTTGGTGCTGGG + Intronic
961602439 3:128072208-128072230 GTGGCCTACCACTGGGGGCTTGG - Intronic
962967345 3:140367022-140367044 GTGATTAAGCACTTGGTGCTGGG + Intronic
965839696 3:172889910-172889932 TTGCCTTATCACTTGGTCCAAGG + Intronic
966277956 3:178198379-178198401 GTATTTTATCATTTGGTGCTAGG + Intergenic
966325535 3:178749374-178749396 GGGGCTTATAGCTTTGTGCTAGG - Intronic
966473227 3:180316069-180316091 GTTGCTTCTGACCTGGTGCTGGG - Intergenic
967697898 3:192554633-192554655 GTGCCTTATAACTTTGTGTTGGG - Intronic
968604891 4:1530488-1530510 CTGGCTCATCCCCTGGTGCTGGG + Intergenic
968901364 4:3433495-3433517 GTGGCATGGCACGTGGTGCTGGG - Intronic
968901383 4:3433563-3433585 GTGGCATGGCACGTGGTGCTGGG - Intronic
968901402 4:3433631-3433653 GTGGCATGGCACGTGGTGCTGGG - Intronic
972592950 4:40505262-40505284 GTGGCTGATCACTTGAGGCCAGG + Intronic
973716426 4:53681704-53681726 GTCACTTTTCACCTGGTGCTAGG + Intronic
978336933 4:107679207-107679229 GTGGCTTATCACTTGGTGCTAGG - Intronic
981933144 4:150211297-150211319 CTCTCTTATCACTTGGTTCTGGG - Intronic
987167813 5:15219474-15219496 ATGTCTTATCACTTGGTACCTGG - Intergenic
987551971 5:19394686-19394708 GTGTCTTGTCACTCTGTGCTAGG - Intergenic
990052985 5:51531068-51531090 GTGTCTTATCAGTTGGGGTTGGG - Intergenic
995540333 5:113179757-113179779 GTGTGTTATAAATTGGTGCTAGG - Intronic
1006716613 6:36124485-36124507 GTGCCTTATCTTTTGCTGCTGGG + Intergenic
1007142774 6:39592559-39592581 GTGGTTTCTCACTTGATGTTTGG + Intronic
1010532614 6:76987754-76987776 CTAGCTTGTTACTTGGTGCTAGG + Intergenic
1010710207 6:79165084-79165106 GTGGATTATCACTTGAGGCCAGG + Intergenic
1015647598 6:135411095-135411117 CTCCCTTATCACTAGGTGCTGGG + Intronic
1018323650 6:162640130-162640152 CTGGCTTGGCACTTGGTACTTGG - Intronic
1022433181 7:30348292-30348314 TTGGCTCTTCACTTGTTGCTTGG + Intronic
1024473431 7:49787078-49787100 GTGGCTGAGAACTTGGTGGTGGG - Intronic
1024777051 7:52799740-52799762 TCTGCATATCACTTGGTGCTTGG + Intergenic
1029863395 7:103600123-103600145 GTGGAGTATCACTTGAGGCTAGG - Intronic
1046435648 8:114184663-114184685 GTTCCTTATCACTTGTTGCCTGG - Intergenic
1058827162 9:108785122-108785144 GTGGCTTGTTACTTGGTGTAAGG - Intergenic
1058834044 9:108845040-108845062 GTGGCCTCTCACTTCTTGCTGGG + Intergenic
1059333212 9:113549579-113549601 GTGGTTTATCTCTGGGTGCTGGG - Intronic
1061175663 9:128994978-128995000 GTGGCCTACCACTGGGTGCATGG + Intronic
1197504702 X:127287417-127287439 GTGGCTTTTTGCTTGGTACTGGG - Intergenic
1201316409 Y:12651306-12651328 GTTGCATATCACTAGGTGCCTGG - Intergenic