ID: 978337628

View in Genome Browser
Species Human (GRCh38)
Location 4:107686802-107686824
Sequence CACTAGCCAGAGTTGGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978337628_978337635 25 Left 978337628 4:107686802-107686824 CCGAGCCCCAACTCTGGCTAGTG 0: 1
1: 0
2: 2
3: 12
4: 206
Right 978337635 4:107686850-107686872 GACTCATTTAGTCCAGCACCAGG 0: 1
1: 0
2: 1
3: 8
4: 80
978337628_978337633 -6 Left 978337628 4:107686802-107686824 CCGAGCCCCAACTCTGGCTAGTG 0: 1
1: 0
2: 2
3: 12
4: 206
Right 978337633 4:107686819-107686841 CTAGTGAACAGGATTCCAAAAGG 0: 1
1: 0
2: 0
3: 4
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978337628 Original CRISPR CACTAGCCAGAGTTGGGGCT CGG (reversed) Intronic
900008848 1:88113-88135 CTCTAGTCAGAGTTGGGTCAGGG - Intergenic
900025172 1:265887-265909 CTCTAGTCAGAGTTGGGTCAGGG - Intergenic
900028772 1:355269-355291 CTCTAGTCAGAGTTGGGTCAGGG - Intergenic
901080654 1:6581953-6581975 GACTTGTCAGGGTTGGGGCTTGG + Intronic
902797463 1:18808751-18808773 CCCCAGGCAGAGTCGGGGCTTGG + Intergenic
903187252 1:21635616-21635638 CACCAGCCCTAGCTGGGGCTGGG + Intronic
905174230 1:36125918-36125940 AACTAGGCAGAGTTTGGGCGAGG + Intergenic
913563305 1:120045499-120045521 CATAAGCTAGAGTTAGGGCTTGG - Intronic
913634818 1:120748081-120748103 CATAAGCTAGAGTTAGGGCTTGG + Intergenic
914283902 1:146204860-146204882 CATAAGCTAGAGTTAGGGCTTGG - Intronic
914544933 1:148655599-148655621 CATAAGCTAGAGTTAGGGCTTGG - Intronic
914621637 1:149415089-149415111 CATAAGCTAGAGTTAGGGCTTGG + Intergenic
917972977 1:180220260-180220282 CCCTAGGCAGAGGTGGGGCGAGG + Intergenic
920387029 1:205576494-205576516 CACTTCCCAGAGATGTGGCTTGG - Intronic
923911699 1:238453852-238453874 CACTTGCCAAAGGTGGGGCCAGG + Intergenic
924103900 1:240631589-240631611 CACTAGCCACAGGTGGCTCTAGG + Intergenic
1063350055 10:5346051-5346073 CTCTATCCAGTGTTGGGGCCAGG - Intergenic
1067061056 10:43078057-43078079 CGCCAGCCAGCGTTGGTGCTGGG + Intronic
1067791608 10:49292588-49292610 AACTAGGCATAGGTGGGGCTTGG - Intergenic
1068974335 10:62992322-62992344 AACTAACTAGATTTGGGGCTAGG - Intergenic
1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG + Intronic
1070531705 10:77342837-77342859 CACTTCCCAGTGATGGGGCTCGG - Intronic
1071561919 10:86651804-86651826 CACCAGCCAGAGTTGGGACTGGG + Intergenic
1073116451 10:101094375-101094397 CAGGAGCCAGGGTTGGGGCGGGG + Intronic
1073319469 10:102605795-102605817 CAGAAGCCAGAGGTTGGGCTGGG + Intronic
1074533908 10:114315183-114315205 CAGTAGCCAGAATTGGGGCTGGG + Intronic
1074764733 10:116692201-116692223 CCCTAGCCAGGGTGGGAGCTGGG - Intronic
1075742006 10:124701689-124701711 CACTGGCCAGAGTGGGGGAAAGG + Intronic
1076294802 10:129376069-129376091 TACTGGCAAGGGTTGGGGCTGGG - Intergenic
1079953424 11:26832936-26832958 CACTAGCCGGACTTGGTGGTGGG + Intergenic
1080279218 11:30537375-30537397 AACTATCAAGGGTTGGGGCTGGG - Intronic
1081045634 11:38269902-38269924 CAATGGCCAGAGCTGGGCCTTGG + Intergenic
1081206103 11:40277364-40277386 AAATATCCAGAGTTGTGGCTGGG + Intronic
1084731722 11:71077966-71077988 CAGTAGGCAGAGTTAGGGATGGG - Intronic
1085025928 11:73236612-73236634 CTCAAGGCAGGGTTGGGGCTGGG + Intergenic
1085346180 11:75769348-75769370 CACCAGCCGCAGTGGGGGCTGGG - Intronic
1085707434 11:78799279-78799301 CAATGACCAGTGTTGGGGCTGGG + Intronic
1087137107 11:94732088-94732110 CACTAGCCAGTGGTGGGGAGAGG - Intronic
1089183186 11:116596824-116596846 CAATAGCCTGAGCTGGGACTTGG + Intergenic
1089651763 11:119919174-119919196 CACTATGCAGAGGTGGGGATAGG + Intergenic
1089806630 11:121096462-121096484 CTTTAGCCAGAGTAGGGGCAGGG + Intergenic
1090398622 11:126434814-126434836 CACAAGCCACAGCAGGGGCTGGG + Intronic
1091476829 12:783352-783374 CAATAACCATACTTGGGGCTGGG + Intronic
1091907575 12:4201327-4201349 TTCCAGCCAGAGTTGGGGTTTGG - Intergenic
1091964729 12:4729432-4729454 CAGGAGCCAGGGTGGGGGCTGGG - Intronic
1096196383 12:49651418-49651440 CACCAGGGAGAGGTGGGGCTGGG + Exonic
1096231403 12:49898821-49898843 CACAAGCCAGAGTCAGAGCTGGG - Intronic
1097779158 12:63684085-63684107 TACTTGCCAGAGTTAGGGTTGGG - Intergenic
1099305882 12:80955283-80955305 CACTACCCAGAGTTTTGACTTGG - Intronic
1102005668 12:109587833-109587855 CACTATTGAGATTTGGGGCTGGG + Intronic
1102590783 12:113955366-113955388 GTCTGGCCAGAGGTGGGGCTAGG + Intronic
1106125579 13:26897875-26897897 GGCCAGCCAGAGCTGGGGCTGGG + Intergenic
1107458237 13:40575408-40575430 CACTTGCCAGGGGTGGGGGTAGG + Intronic
1107752963 13:43588909-43588931 CACTTGCCAGAGGTGGGGTGAGG + Intronic
1107952810 13:45479692-45479714 GACTGGGCAGAGCTGGGGCTTGG + Intronic
1108566699 13:51706550-51706572 CTCTATCCAGAGTTGGGGTCAGG - Intronic
1109211311 13:59538622-59538644 CACTACCTAGAGTTGGGGGAGGG + Intergenic
1115365755 14:32555244-32555266 CACTTGCTAGAGATGGAGCTGGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120827644 14:88969915-88969937 CAGTGGCCAGAGCTGGGGCTTGG - Intergenic
1120828576 14:88977721-88977743 CACTAGCAAGTAGTGGGGCTGGG + Intergenic
1121487843 14:94332145-94332167 CACTGGCCAGATGTGGGACTAGG - Intergenic
1122378750 14:101286727-101286749 CTCTAGTCAGAGCTGGGGGTGGG - Intergenic
1123010600 14:105347866-105347888 CACTAGGCAGAGTGGAGGGTAGG + Intronic
1127968702 15:63942721-63942743 AACTAGCCAGGTTTGGGGTTGGG - Intronic
1128555803 15:68630995-68631017 CACTTGCCAGAACTGGGTCTTGG + Intronic
1129670773 15:77606566-77606588 CAGCACCCAGAGCTGGGGCTGGG - Intergenic
1131567470 15:93499758-93499780 TACAAGGCAGAGTTGGGGCCAGG + Intergenic
1132284975 15:100656438-100656460 CACCTGCCAGGGATGGGGCTGGG - Intergenic
1133930023 16:10224422-10224444 CACAACCCACAGGTGGGGCTGGG + Intergenic
1134808595 16:17147225-17147247 CACTAGCCAGAGTCAAGGCAGGG - Intronic
1135468218 16:22705607-22705629 CAAGAGTCAGGGTTGGGGCTTGG + Intergenic
1137937928 16:52652514-52652536 CACTCCCCACAGCTGGGGCTTGG + Intergenic
1138336851 16:56260210-56260232 CAGTAGCGAGAGCTGGGCCTGGG - Intronic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1138466192 16:57192862-57192884 AATTAGCCAGAGTGGCGGCTTGG - Intronic
1138531333 16:57635957-57635979 CACGAGGCAGAGCTGGGGCAGGG - Intronic
1142006669 16:87692555-87692577 CACTGGCCACAGATGGGCCTGGG + Intronic
1142006682 16:87692599-87692621 CACTGGCCACAGATGGGCCTGGG + Intronic
1142183849 16:88685359-88685381 CAGAACCCAGAGTTGGGGATGGG - Intronic
1142455490 16:90218851-90218873 CTCTAGTCAGAGTTGGGTCAGGG + Intergenic
1145002521 17:19315196-19315218 CACCAGCCAAAGGAGGGGCTGGG - Intronic
1147645551 17:42031646-42031668 CACTGGCCAGCGTTGGGATTGGG + Exonic
1147761105 17:42798075-42798097 CCCTTGCCAGAGCTCGGGCTCGG + Exonic
1151328584 17:73393699-73393721 CACCAGCCAGAATCGGGGCTGGG + Exonic
1151766855 17:76137321-76137343 CACTGTCCAGAGGTGGGGCAGGG + Exonic
1152092216 17:78253233-78253255 CACAACCCAGGGCTGGGGCTGGG + Intergenic
1152551637 17:81033314-81033336 CACTGGCCTGAGTTGGGTCTGGG - Intergenic
1152950986 17:83231288-83231310 CTCTAGTCAGAGTTGGGTCAGGG + Intergenic
1153740134 18:8116526-8116548 CACTGGCCAGAGGTGCTGCTGGG - Intronic
1156833576 18:41525362-41525384 CACTGGACAGAGTTGGGGACAGG + Intergenic
1160318182 18:77867204-77867226 CACAGGCAAGGGTTGGGGCTGGG + Intergenic
1160691708 19:463435-463457 CTCCAGCCTGAGTTTGGGCTGGG + Exonic
1161575714 19:5053208-5053230 CCCTCGCCAGGGTTGGGCCTCGG - Intronic
1161587129 19:5111560-5111582 CACTTCCCAGAGGAGGGGCTGGG - Intronic
1163150911 19:15413438-15413460 CACTTTCCAGAGTAGGGACTGGG + Intronic
1163223099 19:15935608-15935630 CACTACCCACAGTTAGGGCAAGG - Intergenic
1163587711 19:18173102-18173124 CCCAAGCCAGAAGTGGGGCTGGG + Intronic
1167115393 19:47486594-47486616 AAGTATCCAGACTTGGGGCTGGG - Intergenic
1167716887 19:51147776-51147798 CTCTAGACAGTGTTGGGGGTGGG - Intronic
1168534396 19:57156959-57156981 CACTATTAAGAGTTGTGGCTGGG - Intronic
927526186 2:23743269-23743291 TACTAACAAGAGTTGGGGCCAGG + Intergenic
929555116 2:42921162-42921184 CACTGGCCAGGATTGAGGCTTGG + Intergenic
930741355 2:54835852-54835874 CACTATCAACATTTGGGGCTGGG - Intronic
931404847 2:61966190-61966212 CTATCGCCAGATTTGGGGCTTGG + Intronic
934320510 2:91967384-91967406 CACTAGCTAGAGATGGGTGTAGG + Intergenic
935328402 2:101959034-101959056 CACTAGGCAGAGATGGGCATGGG + Intergenic
935393436 2:102579887-102579909 CATTAGCCAGAGCCAGGGCTTGG - Intergenic
936181948 2:110274761-110274783 AACTAAGCAGAGCTGGGGCTAGG + Intergenic
936230620 2:110696912-110696934 AACTAAGCAGAGCTGGGGCTAGG - Intergenic
937370611 2:121294945-121294967 CACTAGCCAAGGTGGGGGCTAGG + Intergenic
937758025 2:125564654-125564676 CACTAGGCTGAATTTGGGCTCGG - Intergenic
938581913 2:132654144-132654166 CACTAGCCAAAGATGGGGGAAGG + Intronic
938620075 2:133042261-133042283 CACTTGCCAGACTTTGGACTGGG - Intronic
939706288 2:145457590-145457612 CACCAGCCAGAGCTGGAGATTGG - Intergenic
939917424 2:148064594-148064616 GAATAGGCAGGGTTGGGGCTGGG - Intronic
942449574 2:176100472-176100494 CAATAGACAGAGTACGGGCTGGG + Intronic
942485221 2:176432111-176432133 CATTAGCAGGAGTGGGGGCTGGG + Intergenic
945159057 2:206870341-206870363 CAGGAGCCAGAGTTGGGCCAGGG + Intergenic
946357818 2:219199649-219199671 CTCTAGCCAGAGGCGGGGCCTGG - Intronic
948188433 2:236040204-236040226 CACTCGCCAGGGTGGGGGCAGGG - Intronic
949086987 2:242163648-242163670 CTCTAGTCAGAGTTGGGTCAGGG + Intergenic
1169113774 20:3049478-3049500 CTCTGGCCAGAGTTGATGCTGGG - Intergenic
1169530972 20:6484412-6484434 CAATGGCCAGAATTGGGACTGGG + Intergenic
1169829188 20:9804751-9804773 CACTATCCAGAGTGTGGGCCAGG + Intronic
1169840083 20:9926218-9926240 CATTAGCCAGGGTTGGGGGAAGG + Intergenic
1172909061 20:38392782-38392804 CACATGCCACAGTTGGGGATGGG - Intergenic
1173219953 20:41124519-41124541 CTCAGGCCAGAGTTGGGGCTGGG + Intergenic
1183543950 22:38445813-38445835 CACTGGCCTGAGTGGGGGTTAGG + Intronic
1183711358 22:39505557-39505579 AAATAGCCAGAGTTGAGGCTGGG + Intronic
954086004 3:48244610-48244632 CAAAAGCCAGAGTTGTTGCTGGG + Intronic
954331000 3:49890239-49890261 TCCTACCCAGAGTTGGGGCTGGG + Intronic
954364526 3:50139019-50139041 CACCCCACAGAGTTGGGGCTGGG - Intergenic
954912623 3:54122183-54122205 CCCTAGCCAGGGTGGGGGTTGGG - Intergenic
954941487 3:54377036-54377058 CCCTGGCCATAGTTGGGGCCTGG + Intronic
955121400 3:56062919-56062941 CCGAAGCCAGAGTTGGGGCAGGG - Intronic
955922401 3:63971237-63971259 AATTAGCCAAAATTGGGGCTGGG - Intronic
955957824 3:64308722-64308744 AACTAGCCAGATTTAGGGCCGGG - Intronic
958705681 3:97651994-97652016 TACTAGACAGAGGTGGGGTTAGG - Intronic
959938170 3:112052147-112052169 CTATAGCCTGAGTTGGGGGTGGG + Intronic
962567340 3:136674932-136674954 CTCTAGCAAAAGTTGGGGGTTGG + Intronic
962928139 3:140013797-140013819 CACTAGCCAGCGTTAGAGGTGGG + Intronic
964178286 3:153852533-153852555 GTATAGCCAGAGTTGAGGCTAGG - Intergenic
966316088 3:178646696-178646718 TACTATCCAGAGCTGTGGCTTGG - Intronic
967273247 3:187748214-187748236 AACCAGCCAGAGTGGGGGCTGGG + Intergenic
968174735 3:196539761-196539783 GACTAGCCAGAGTTTGAACTGGG - Intergenic
968966098 4:3769745-3769767 GACTTGCCAGAGTTGGCCCTTGG + Intergenic
969450896 4:7272666-7272688 CACCAGCGTGAGATGGGGCTTGG + Intronic
969638075 4:8380884-8380906 CCCTAGACAGGGTGGGGGCTGGG + Intronic
971156323 4:24087191-24087213 CACTAGCCAGCGCTGGAACTTGG + Intergenic
972735543 4:41837546-41837568 CACCATCCAGAGTTAGGCCTGGG - Intergenic
975213541 4:71728706-71728728 AACTGGGCAGAGATGGGGCTGGG - Intergenic
977155696 4:93570196-93570218 CAGTAGCCAGTGGTGGAGCTGGG + Intronic
978247296 4:106589306-106589328 CAAAAGCCAGAGGTGGGGTTGGG + Intergenic
978337628 4:107686802-107686824 CACTAGCCAGAGTTGGGGCTCGG - Intronic
993636598 5:90351984-90352006 CAGTAGCCAGAGTATGAGCTTGG - Intergenic
993877939 5:93329882-93329904 CAGAAGCCAGAGTTGGGGGATGG - Intergenic
995295018 5:110510292-110510314 GACAAGGCAGAGTTGGGGGTAGG - Intronic
997363710 5:133311995-133312017 CATTAACCAGAGGTGGTGCTGGG - Intronic
997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG + Intergenic
999490474 5:152045402-152045424 ACCTGGCCAGAGTTGGGGGTGGG + Intergenic
1000281324 5:159784850-159784872 CTATAGCCTGAGTTGGGGTTGGG + Intergenic
1001961809 5:175884183-175884205 CCGCAGCCAGAGTTGGGACTGGG + Intergenic
1002745218 5:181465102-181465124 CTCTAGTCAGAGTTGGGTCAGGG + Intergenic
1002910758 6:1489289-1489311 TACTCCCCAGGGTTGGGGCTGGG + Intergenic
1005870528 6:29971608-29971630 CCCTGGACAGAGTTGGGGGTCGG + Intergenic
1006644533 6:35506761-35506783 AACTAGTAAGAGGTGGGGCTGGG + Intronic
1007064342 6:38974715-38974737 CAATAGTCAGGGTTGGGGGTTGG - Intronic
1007097819 6:39225022-39225044 CTCAAGCCAGAGTGGGGTCTTGG - Intronic
1008121518 6:47622332-47622354 CCCTACCCAGAGTTGTGGCCTGG + Intronic
1012395370 6:98790440-98790462 CCACAGCCAGAGTTGGGCCTGGG - Intergenic
1014641350 6:123914647-123914669 CACTAGCAAGCTTTAGGGCTAGG + Intronic
1018029441 6:159830476-159830498 CAATAGCAAGAGCTGGGGCAGGG - Intergenic
1018444350 6:163841652-163841674 CACCAGCCAGAGTTATCGCTGGG - Intergenic
1018847363 6:167564961-167564983 CACTGCCCACAGTTGGGGGTGGG - Intergenic
1019250126 6:170738648-170738670 CTCTAGTCAGAGTTGGGTCAGGG + Intergenic
1021576489 7:22110034-22110056 CAGAAGCCAGAGGTGAGGCTGGG + Intergenic
1022938082 7:35201730-35201752 TACTTGCCAGAGTTAGGGTTGGG - Intergenic
1023264554 7:38392136-38392158 CACTAGCCAGACTCAGGTCTGGG + Intronic
1024048587 7:45601902-45601924 CACTAACCAGGCTTGGGGCAGGG + Intronic
1025095401 7:56092164-56092186 CCCCAGTCAGAGCTGGGGCTGGG - Intronic
1026168979 7:67936300-67936322 CAAGAGCCAGAATTGGGGCCGGG - Intergenic
1028299609 7:89181144-89181166 CACTATCTAGGGTTGGGGATGGG + Intronic
1028844794 7:95467722-95467744 CACTGCCCACAGGTGGGGCTAGG - Intergenic
1029419971 7:100467353-100467375 CAGTAGCCAGACTAGAGGCTGGG + Intronic
1029447472 7:100621885-100621907 AACAAACCAGAGATGGGGCTAGG - Intronic
1032017944 7:128391817-128391839 CACCAGCCGGGGTTGAGGCTGGG + Intergenic
1033554486 7:142476894-142476916 CACAACCCAGAGTTGCTGCTTGG - Intergenic
1033556766 7:142495000-142495022 CACAACCCAGAGTTGCTGCTTGG - Intergenic
1033559117 7:142514439-142514461 CACAACCCAGAGTTGCTGCTTGG - Intergenic
1035497739 8:67692-67714 CTCTAGTCAGAGTTGGGTCAGGG - Intergenic
1036527883 8:9552319-9552341 CACAAGCCAGAGCTGTGGTTTGG - Intergenic
1037918761 8:22789386-22789408 GACTAGTCAGAGATGGGGGTGGG + Intronic
1038005119 8:23423541-23423563 AACTAGCCAGTGGTGGGGCTGGG - Intronic
1038338240 8:26662499-26662521 AAGTGGCCAGAGTTGGGGATCGG - Intergenic
1038427531 8:27473951-27473973 CACCAGCCAGTGGTGGGGCCAGG - Intronic
1040871184 8:52101208-52101230 CTCCAGGCAGAGATGGGGCTGGG + Intergenic
1041588648 8:59550270-59550292 CCCTCCCCAGAGGTGGGGCTGGG - Intergenic
1042185324 8:66131000-66131022 GACTAGCCACAGTTGGGAGTGGG + Intronic
1044159268 8:88892890-88892912 CACTGGCCAGAGGTGTGACTGGG + Intergenic
1048150727 8:131891002-131891024 TCCTAGACACAGTTGGGGCTGGG - Intergenic
1048331178 8:133471771-133471793 ACCTGGCCAGAGTTGGTGCTAGG + Intronic
1048967477 8:139625120-139625142 CGCCAGCCTGAGGTGGGGCTCGG - Intronic
1049774917 8:144399765-144399787 CACCAGCGTGAGTTGGGACTAGG - Exonic
1051371633 9:16364165-16364187 CACAAGCCAGACTTGGGACAGGG - Intergenic
1055668292 9:78573910-78573932 CACTGGCCAGAGTAGTGACTCGG + Intergenic
1057168871 9:92948963-92948985 CACTGGGCAGAGGTTGGGCTGGG + Intronic
1057268101 9:93631970-93631992 CTCTTGCATGAGTTGGGGCTGGG + Intronic
1203579686 Un_KI270745v1:31233-31255 CTCTAGTCAGAGTTGGGTCAGGG + Intergenic
1187569883 X:20490088-20490110 TAATGGCCAGAGTTGGGGCTTGG - Intergenic
1188104471 X:26133028-26133050 CACTCACCAGGGCTGGGGCTAGG + Intergenic
1189347421 X:40252589-40252611 CCAAAGCCAGAGTTGGGGCAAGG + Intergenic
1190404527 X:50073408-50073430 AACTAGCAAGTGGTGGGGCTTGG - Intronic
1190688364 X:52893653-52893675 CTCCAGCCAGGGTTTGGGCTTGG + Intronic
1190697619 X:52962139-52962161 CTCCAGCCAGGGTTTGGGCTTGG - Intronic
1192445514 X:71208205-71208227 CACTTCACAGTGTTGGGGCTGGG - Intergenic
1192477696 X:71457711-71457733 CACTAGCAAGTGTTGGGGCCAGG + Intronic
1193986748 X:88252208-88252230 GACTAGCCAGAGATGAGGCCTGG - Intergenic
1194049868 X:89055163-89055185 CATTACCCAGAGCTAGGGCTAGG + Intergenic
1196398861 X:115293027-115293049 CACTGGCCAGGGCTGGGACTAGG + Intronic
1200428148 Y:3045398-3045420 GGCTGGCCAGAGTTGGGGTTGGG + Intergenic