ID: 978337630

View in Genome Browser
Species Human (GRCh38)
Location 4:107686808-107686830
Sequence CCTGTTCACTAGCCAGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978337630_978337635 19 Left 978337630 4:107686808-107686830 CCCAACTCTGGCTAGTGAACAGG 0: 1
1: 0
2: 1
3: 3
4: 104
Right 978337635 4:107686850-107686872 GACTCATTTAGTCCAGCACCAGG 0: 1
1: 0
2: 1
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978337630 Original CRISPR CCTGTTCACTAGCCAGAGTT GGG (reversed) Intronic
908363932 1:63398205-63398227 CCTGTTCCCTAGTCAGAGTTTGG + Intronic
910119340 1:83768238-83768260 CAAGTTATCTAGCCAGAGTTGGG + Intergenic
920422640 1:205845474-205845496 CCTGTTCACTATCCAAGGCTCGG - Exonic
921674407 1:217962287-217962309 CCTTTTCACTCCCCAGAGGTTGG - Intergenic
922222072 1:223616255-223616277 CCTGCTTACTAGGCACAGTTTGG - Intronic
1062853965 10:770120-770142 GCCGTTCACTGGCCAGAGTTAGG - Intergenic
1067959771 10:50835040-50835062 CCTCTTCACTGGCCAGCATTTGG - Intronic
1069415497 10:68196954-68196976 CCTGTTTATTACCCAGAGTAAGG - Intronic
1071576916 10:86734011-86734033 CCTCTTCCCCACCCAGAGTTTGG - Exonic
1074460190 10:113629677-113629699 CCAGGTCACTGGCGAGAGTTTGG + Exonic
1076244800 10:128938479-128938501 CCTCTTCTCTAGCCAAAGTCAGG - Intergenic
1076536477 10:131181147-131181169 CCAGTTCTCCAGCCAGAGCTGGG + Intronic
1076774792 10:132689203-132689225 CCTGTTCAGAATGCAGAGTTGGG + Intronic
1077498013 11:2896075-2896097 CCTGCTCACCAGCCAGAACTGGG - Intronic
1078060534 11:8039982-8040004 TCTGTTCACTAGCCTGTGCTGGG + Intronic
1079827809 11:25220272-25220294 GCTGTTCAATAACCAGTGTTAGG - Intergenic
1081666483 11:44919876-44919898 CCTCTTCACTATCCAGGGTCAGG - Exonic
1083525296 11:63359275-63359297 CCTCTTCTCTAGCAAGAGTGAGG + Intronic
1086338707 11:85825571-85825593 CCTGATCTCTAGCAAGATTTGGG + Intergenic
1088946767 11:114521624-114521646 CCTTTTCAATAGACAGAGCTAGG + Intergenic
1092078005 12:5689271-5689293 CCTGTTCTCTAACCAAAATTAGG - Intronic
1092508522 12:9128288-9128310 CCTGGTCACCAGCCAGACTGAGG + Intergenic
1094674066 12:32600954-32600976 CCTATCCATAAGCCAGAGTTAGG - Intronic
1099451177 12:82808750-82808772 CCTTTTTACTGGACAGAGTTTGG + Intronic
1100504384 12:95205363-95205385 TCTGTTTACTAACCAGAATTTGG + Intronic
1100598976 12:96096315-96096337 CCTGTTCACCAACCTGAGGTGGG + Intergenic
1101344524 12:103873891-103873913 TCTGTGCAATAGCCAGAATTAGG - Intergenic
1108167205 13:47706202-47706224 TATTTTCAGTAGCCAGAGTTGGG - Intergenic
1115128075 14:30020122-30020144 CCAGTTCACTATCTAGAGATAGG + Intronic
1116441176 14:44955331-44955353 CCTTTTCAGTAGACAGAGCTAGG - Intronic
1117832204 14:59763349-59763371 GCTGTTGATGAGCCAGAGTTTGG + Intronic
1120097876 14:80409342-80409364 CCTGTTCTCTTGCTAGAATTAGG - Intergenic
1121805239 14:96813622-96813644 TCTTTTCACTTGACAGAGTTAGG + Intronic
1122716844 14:103701084-103701106 CCTCTTCTCTAGGCAGACTTGGG + Intronic
1124454669 15:29830702-29830724 CCTTTTCAATGGCCAGAGCTAGG - Intronic
1125532669 15:40423838-40423860 CCTGTCCACGGGCCAGTGTTTGG + Intronic
1126101611 15:45121334-45121356 CCCGTTAACTAGCCAGGGTCTGG + Intronic
1130153296 15:81328552-81328574 CCTTCACACTAGCAAGAGTTTGG - Intergenic
1137323092 16:47406541-47406563 CCTGTTGAATAGCCACATTTTGG - Intronic
1138486483 16:57348228-57348250 CCTAATCTCTAGCCAGTGTTTGG - Intergenic
1145002524 17:19315202-19315224 CCTGTTCACCAGCCAAAGGAGGG - Intronic
1147486246 17:40817539-40817561 CCTGATCACTGGGCACAGTTGGG + Intergenic
1150850913 17:68702938-68702960 ACTTCTCACTAGCCAGAGATAGG - Intergenic
1153539624 18:6139940-6139962 CCTGAGCATTTGCCAGAGTTGGG - Intronic
1153954349 18:10083423-10083445 CCTGACCCCCAGCCAGAGTTAGG - Intergenic
925641985 2:5994146-5994168 TCTGTTCTCTCGCCAGAGTCTGG + Intergenic
927096356 2:19750339-19750361 CCTGGTCCCTAGCCAGTGCTTGG - Intergenic
929619927 2:43344121-43344143 CCTCTTGGCCAGCCAGAGTTTGG + Exonic
929792099 2:45031000-45031022 CCTCTACACTAGGCAGATTTGGG - Intergenic
931078982 2:58747669-58747691 CATGTTCACTAGACAGATTATGG + Intergenic
931734739 2:65183502-65183524 CATTCTCACTAGTCAGAGTTGGG + Intergenic
932126549 2:69150062-69150084 TCTGGTCCCTAGCCAGAGCTTGG - Intronic
932153482 2:69394018-69394040 CCAGTTTACTGGCCAGAGCTAGG + Intergenic
943167065 2:184342902-184342924 AAAGTTCACTTGCCAGAGTTTGG - Intergenic
947231787 2:227894708-227894730 CCTGTTCATTATCTAGAGGTTGG - Intronic
1169260392 20:4134307-4134329 CCTGGTCACTCGCTAGAGCTTGG - Intronic
1170927496 20:20738718-20738740 CCAGTGCACTTGGCAGAGTTAGG + Intergenic
1172494577 20:35370475-35370497 TTTATTCACTAGCCACAGTTTGG + Intronic
1179834821 21:44023721-44023743 CCTTTTCAATAGGCAGAGCTAGG + Intronic
1180145164 21:45914701-45914723 CCTGTGCCCTGGCCAGGGTTTGG - Intronic
949831293 3:8217396-8217418 GATGCTCACTGGCCAGAGTTAGG + Intergenic
950315691 3:12000117-12000139 CCTGCTCACTACCCAGGGTCAGG - Intergenic
952324944 3:32312697-32312719 CCTCTTCCCTACCCAGAGGTTGG + Intronic
958441490 3:94161556-94161578 CCTCTTCACTAGGCAGTATTTGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961761295 3:129170371-129170393 CCTCTTCACTGGCCAAAGGTTGG - Exonic
973345685 4:49052275-49052297 GCTGTTCACTGGCAAGAGTGAGG - Intronic
974085687 4:57258431-57258453 CCTGTTCAATAAACAGTGTTGGG - Intergenic
974880320 4:67748581-67748603 AGTGTTCACTGGGCAGAGTTGGG + Intronic
978337630 4:107686808-107686830 CCTGTTCACTAGCCAGAGTTGGG - Intronic
979969548 4:127116839-127116861 CCTGATCATTAGCAAGAGGTAGG - Intergenic
989120765 5:38002355-38002377 CCTGTTCAATCTCCTGAGTTGGG + Intergenic
991482349 5:67094923-67094945 ACTGTTGACTGGCCAGAGCTGGG + Intronic
993699934 5:91106948-91106970 CTGCTACACTAGCCAGAGTTAGG - Intronic
997967945 5:138374817-138374839 CCTGATCCCTAGGCAGAATTAGG + Intronic
1000105484 5:158055115-158055137 ACTGTTCCCCAGCTAGAGTTAGG - Intergenic
1003328166 6:5108624-5108646 TCTGTCCACCAGCCAGATTTGGG + Exonic
1003440743 6:6139301-6139323 CTTCTTCACTGGCCTGAGTTAGG + Intergenic
1004518492 6:16340819-16340841 CCTGTTCCCTGGCCACAGTTTGG - Intronic
1009484542 6:64203390-64203412 CCTAGTCACGAGCCAGAGTGAGG + Intronic
1010986895 6:82435071-82435093 CCTGTACTCTAGCCACATTTAGG + Intergenic
1015570715 6:134618711-134618733 CCTCCTTACTAGCCAAAGTTGGG - Intergenic
1016941218 6:149484126-149484148 CCTGTTCACGAGTCAGGGATGGG + Intronic
1018361741 6:163077820-163077842 CCTGGTCACTCGCCAGAGGAAGG + Intronic
1023401012 7:39793047-39793069 GCTGTTCTCCAGCCAGAGCTGGG - Intergenic
1024648620 7:51387730-51387752 GCTGTTCTCCAGCCAGAGCTGGG + Intergenic
1025695391 7:63771937-63771959 GCTGTTCTCCAGCCAGAGCTGGG + Intergenic
1025912656 7:65840586-65840608 GCTGTTCTCAAGCCAGAGCTGGG - Intergenic
1032332701 7:130994732-130994754 CCTGTTCATTTTCCACAGTTTGG - Intergenic
1033585245 7:142770084-142770106 CCTGATCACATGTCAGAGTTTGG - Intergenic
1033873632 7:145787532-145787554 GCTGTTCAGTAGGCAGAGGTAGG - Intergenic
1034887134 7:154806546-154806568 CCTGCTCACATGCCAGCGTTTGG + Intronic
1036280011 8:7392729-7392751 CCTGGTCACTGGGCAGAATTTGG + Intergenic
1036341514 8:7919154-7919176 CCTGGTCACTGGGCAGAATTTGG - Intergenic
1037329596 8:17731290-17731312 CCTGCTCACTAGGCAGTGTGAGG - Intronic
1039466647 8:37789357-37789379 CCTCTTCCCTGCCCAGAGTTTGG + Intronic
1041499056 8:58519657-58519679 AATGTTAACTGGCCAGAGTTGGG - Intergenic
1045010169 8:97951845-97951867 CCTGTTCACTAACAAGATTTTGG - Intronic
1047066792 8:121292919-121292941 CATTTTCATTAACCAGAGTTTGG + Intergenic
1049736850 8:144212457-144212479 CCTTTTCAGTAGACAGAGCTAGG + Intronic
1053489795 9:38489759-38489781 CAATTTCACTAACCAGAGTTTGG - Intergenic
1056291584 9:85148961-85148983 CCTGTTCCATAGCAAGATTTGGG + Intergenic
1057412334 9:94827809-94827831 CCTGTTCATAAGCCAGAGAGAGG + Intronic
1190389248 X:49915675-49915697 CCTGTTCACTTGCCGGGGGTGGG + Intergenic
1190832795 X:54074336-54074358 CCTGTTCAATTGTCAGCGTTGGG - Intronic
1199853272 X:151740247-151740269 TCTCTCCACTAGCCAGAGGTGGG - Intronic
1202233384 Y:22679331-22679353 CATGTTAACCAGCCACAGTTAGG + Intergenic
1202309772 Y:23516827-23516849 CATGTTAACCAGCCACAGTTAGG - Intergenic
1202561029 Y:26153766-26153788 CATGTTAACCAGCCACAGTTAGG + Intergenic