ID: 978337732

View in Genome Browser
Species Human (GRCh38)
Location 4:107687903-107687925
Sequence CAGAGGGACCATAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978337732 Original CRISPR CAGAGGGACCATAAGGAAGA TGG (reversed) Intronic
900502518 1:3013320-3013342 CAGAGAGACAGAAAGGAAGAGGG - Intergenic
900730537 1:4256032-4256054 CAGAGGGACCCTAAAGAGCAAGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901317826 1:8320902-8320924 CAGAGGGACAGAAAGGGAGATGG + Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903680893 1:25096056-25096078 CATAGAGACTATAAGGACGAAGG + Intergenic
903917482 1:26774880-26774902 CAGAGGGACCATATGGGGGCTGG - Exonic
905446511 1:38031238-38031260 CAGAGGGAACATGAGAAAGAGGG + Intergenic
905776832 1:40673409-40673431 CAGAGGGAACATTGAGAAGAAGG - Intergenic
906647616 1:47487048-47487070 GTGAGGGCCTATAAGGAAGAGGG - Intergenic
906803846 1:48760726-48760748 GAGAAGGACGATAAGGAAGTGGG - Intronic
906864752 1:49405625-49405647 CAAAGGGAAGAAAAGGAAGATGG - Intronic
907091862 1:51732559-51732581 GAGATGGAAAATAAGGAAGATGG - Intronic
907823942 1:57997497-57997519 CTGAGGGGCTATAAGGCAGAGGG - Intronic
913412186 1:118564302-118564324 CAGAAGCAGCCTAAGGAAGATGG - Intergenic
913630972 1:120709549-120709571 CAGAAGGAACATAAGGAGAATGG + Intergenic
915570382 1:156742252-156742274 TAGAGAGACCAGTAGGAAGAGGG + Intronic
915890208 1:159766272-159766294 CAGCAGGACCTTAAGGAAGTGGG + Intergenic
915969358 1:160343006-160343028 CAGACGGACCCGGAGGAAGACGG - Intronic
916896450 1:169168305-169168327 CTGAGGAAGCATAAGGCAGAAGG - Intronic
918122124 1:181549355-181549377 CAGAGTGAGAATGAGGAAGAAGG + Intronic
918899719 1:190398811-190398833 CAGAGGCACATCAAGGAAGAGGG - Intronic
920152667 1:203921186-203921208 AAGAGGAACCACAAGGTAGAGGG - Intergenic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
920949444 1:210558521-210558543 TAGAGGGAGCATAAGGGGGAAGG + Intronic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923994040 1:239471549-239471571 CAGAGGCAGGATCAGGAAGAGGG + Intronic
924157944 1:241200668-241200690 GAGAGGGAGCTTTAGGAAGACGG - Intronic
1063192032 10:3704550-3704572 CAGAGGTACCTTGAGGAAGAAGG + Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1064871279 10:19939635-19939657 CAAAGGGAGAAAAAGGAAGAGGG - Intronic
1065679186 10:28211792-28211814 CAGAGGGAGCAAGAAGAAGAGGG + Intronic
1067220649 10:44341751-44341773 CTGAGGTACCCTGAGGAAGAGGG - Intergenic
1067777095 10:49171687-49171709 CTGGGGGACCATAAGACAGAGGG - Intronic
1067935771 10:50611146-50611168 TAGATGGACCATAAGTGAGATGG - Intronic
1069839939 10:71333504-71333526 CTTAGGGACCATCAGGAAGAGGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070590567 10:77797743-77797765 CACAGGGACCAGGAGGCAGAAGG + Intronic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1072462532 10:95632866-95632888 CAGAGGGACTCAAAGAAAGAGGG + Intronic
1073060970 10:100733430-100733452 CAGAGGGGCCATGAAGAGGAAGG - Intergenic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074418289 10:113286407-113286429 CAGAGGGACCAGATACAAGAGGG - Intergenic
1074950471 10:118329437-118329459 CACAGGGAACATTAGGAAAATGG - Intronic
1076575262 10:131461616-131461638 CAGAGGCAGCCTCAGGAAGATGG - Intergenic
1076883183 10:133249379-133249401 CATAGGGACCATGGGGATGATGG + Intergenic
1078682965 11:13497511-13497533 TAGGGTTACCATAAGGAAGAAGG + Intergenic
1079424034 11:20323429-20323451 CAGAGAGGCAAAAAGGAAGAAGG - Intergenic
1081526614 11:43932022-43932044 AAGTGGGCCCATAAGGATGACGG + Intronic
1082639965 11:55647260-55647282 GAAAGGGGCCATAAGGAAGCTGG + Intergenic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083159115 11:60843775-60843797 GTGAGGGACCATGAGGAAGGAGG + Intronic
1083336639 11:61925679-61925701 CAGAGGGACCAACAGGTAAAAGG + Intergenic
1083580313 11:63820523-63820545 CATAAGGACCATGGGGAAGAAGG - Intronic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1083844274 11:65321804-65321826 CCCAGGGACCTGAAGGAAGAAGG - Exonic
1084196329 11:67525109-67525131 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196346 11:67525151-67525173 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196363 11:67525194-67525216 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085264969 11:75231894-75231916 CAGAGGGACCATCAGGCAGCAGG - Intergenic
1085882691 11:80486424-80486446 GAGAGGAAGCATAATGAAGATGG + Intergenic
1086123370 11:83325073-83325095 CAAACGGACCAAAAGCAAGAGGG - Intergenic
1088950862 11:114568523-114568545 GAGAGGGAAAATAAGAAAGAGGG - Intergenic
1090029718 11:123196114-123196136 CAGAAAGAACATAAGGCAGAGGG + Intergenic
1090609080 11:128454027-128454049 AAGGGAAACCATAAGGAAGAAGG - Intergenic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1096028372 12:48387961-48387983 CATAAGGACAATATGGAAGAGGG + Intergenic
1096193199 12:49633203-49633225 CAGAGGAACCATCATGAATATGG - Intronic
1096686639 12:53292487-53292509 CAGAGGGATCATTAGATAGAAGG - Intronic
1101703414 12:107197024-107197046 CAGAAGGACTTTTAGGAAGAGGG - Intergenic
1102417706 12:112778994-112779016 CAGAAGGACAATCAGGAACAGGG + Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102685490 12:114721302-114721324 CAGAGGGTCAAAAAGGACGAGGG - Intergenic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1109295853 13:60529927-60529949 CAGAGGGACCATCAGAGAGAAGG + Intronic
1110466896 13:75812687-75812709 AAGAGGAACTTTAAGGAAGAAGG - Intronic
1110928322 13:81183669-81183691 CAAAATGACCATAAGGAAGTAGG - Intergenic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1113507986 13:110830435-110830457 CAGAGGGACACCAGGGAAGAGGG + Intergenic
1113779189 13:112966375-112966397 CAGAGGTTCCCTGAGGAAGAGGG - Intronic
1114482426 14:23044098-23044120 CAGAGGGAGCATCAGGAAGGAGG - Exonic
1114852238 14:26395086-26395108 CACCTGGACCACAAGGAAGAAGG + Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115100081 14:29688176-29688198 CAGAGGGACCATAGGGTGAAAGG - Intronic
1118341869 14:64900891-64900913 CAAAGGCACCAAAAGGAACATGG - Intergenic
1119127568 14:72141840-72141862 CTAAGGAACCATAAGGAACATGG - Intronic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1122311897 14:100802767-100802789 CAGCGGTACCAAAAGGACGAGGG - Intergenic
1125287874 15:38113274-38113296 GAGAGGGAGCATAAGGGAAAGGG + Intergenic
1126757150 15:51935955-51935977 CTGAGGGAACATAGGGACGAGGG + Intronic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1128924152 15:71638892-71638914 CTGAGGGACCATAATGAGCAGGG - Intronic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1131535155 15:93231347-93231369 CAGAGGGATGAAAAGGAAGGAGG - Intergenic
1131771543 15:95743091-95743113 CATAGGGACCTTGTGGAAGATGG - Intergenic
1132137094 15:99351915-99351937 CAGAGGCAACATCAGGAATAAGG + Intronic
1132348682 15:101123780-101123802 CAGAGGGACAAAAGCGAAGATGG - Intergenic
1133392652 16:5422442-5422464 GAGAGGGAACATGAGGGAGAGGG + Intergenic
1133645062 16:7756323-7756345 CTGAGGGGTCATAATGAAGATGG - Intergenic
1133747201 16:8696279-8696301 CAGGGGGACCCTGGGGAAGAAGG + Intronic
1134848687 16:17462415-17462437 CAGAGGCATCACAAAGAAGATGG - Intronic
1137446292 16:48534612-48534634 CACAGGGACCACAAGGAAGATGG - Intergenic
1138172243 16:54863512-54863534 AAGAGAGACGAAAAGGAAGAGGG + Intergenic
1138493312 16:57390882-57390904 CAGAGGCCCCATCAGCAAGATGG + Intergenic
1141289654 16:82706051-82706073 AAGAGAGAGAATAAGGAAGAAGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1142534551 17:605445-605467 CTGAGGGACAGAAAGGAAGATGG + Intronic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1142780956 17:2180777-2180799 CAGAGGGACCATTTGGAAGTGGG + Intronic
1143033623 17:3982111-3982133 CATAGGGACCACAAGGGACAGGG + Intergenic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143520646 17:7442428-7442450 CAAAGGGAGGACAAGGAAGAGGG - Intronic
1143756942 17:9074130-9074152 CAGAGGGACCATTTGAGAGAAGG + Intronic
1143965770 17:10755709-10755731 GAGAGGGAGGAAAAGGAAGAGGG - Intergenic
1144457051 17:15427444-15427466 CACATGGACCATAATGAAAATGG - Intergenic
1145084545 17:19925787-19925809 AAGAGGGACCAGAATAAAGAGGG + Intronic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1146126073 17:30232625-30232647 CAGAGGGGCCAAAGGAAAGATGG + Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1148029376 17:44608985-44609007 CAAAGGGAGCAAGAGGAAGAAGG + Intergenic
1148714178 17:49704027-49704049 TAGAGGGATCAAAAGGATGAGGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151290186 17:73144228-73144250 CACAGGTACCTTGAGGAAGATGG + Intergenic
1152253464 17:79223897-79223919 CAGAGGGGCCAAGAGGAACAAGG + Intronic
1152516075 17:80825695-80825717 CACAGTGACCGTCAGGAAGAGGG - Intronic
1153090998 18:1342674-1342696 AAGAGGGAAAATAAGGAAGGAGG - Intergenic
1155400628 18:25435187-25435209 GAGAGGGACCACCAGGAAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156409376 18:36812985-36813007 CAGAGGCACCATAAAGAAAAAGG + Intronic
1159955499 18:74515851-74515873 CAGAGGCACCAGGAGTAAGAGGG - Intronic
1160728400 19:629059-629081 CAGATGAACCACAACGAAGATGG + Intronic
1161132404 19:2599003-2599025 CCGAGGGCCCATGATGAAGAGGG + Intronic
1161155384 19:2729986-2730008 CAGCGGGACCCTAAGGCAGAAGG - Intronic
1164591994 19:29512373-29512395 GAGAGGGAGTATAAGGAGGAAGG + Intergenic
1164592462 19:29514065-29514087 AAGAGGGAGGATAAGGAGGAAGG + Intergenic
1165550617 19:36581691-36581713 AAGAGGGAACAAAAGGGAGAGGG - Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
925200893 2:1967300-1967322 CACAGGGCTCATAGGGAAGAGGG - Intronic
927319733 2:21729215-21729237 AAGATGGACTAGAAGGAAGAAGG - Intergenic
928998911 2:37325707-37325729 CAGAGGGACTACAATCAAGAGGG + Intergenic
931264853 2:60651686-60651708 AGGTGGGACCATAAGAAAGAAGG + Intergenic
932439647 2:71725262-71725284 CAGATGGGCCATAAGGATGGAGG + Intergenic
933092220 2:78135624-78135646 CAGAGGTGACATAAGCAAGATGG - Intergenic
934640434 2:96024345-96024367 CGGAGGGTCCATTATGAAGAAGG + Intronic
934701795 2:96447837-96447859 CACAGGTACAAAAAGGAAGAAGG - Intergenic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
938113842 2:128590284-128590306 GAGAGGGAGCAAAAGGGAGAGGG - Intergenic
938692792 2:133807708-133807730 CTGAGGGACAAGAATGAAGAAGG - Intergenic
939513624 2:143139006-143139028 AAGAGAGACCAAAAAGAAGATGG - Intronic
940016446 2:149111144-149111166 CAGAGGGACCCCCAGGAGGATGG + Intronic
940990512 2:160091887-160091909 CAGTGGGAAAATAAGGAGGAAGG - Intergenic
941061190 2:160849377-160849399 CAGAGATACCATGAGAAAGAAGG + Intergenic
941306501 2:163875486-163875508 GAGGGAGATCATAAGGAAGATGG - Intergenic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
942538420 2:176989979-176990001 CAGATGGTCTATAAGGCAGATGG + Intergenic
942644265 2:178094048-178094070 CAGAAGGAAAATAAGGATGATGG - Intronic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
947029912 2:225782506-225782528 CAGAGGGAAAAAAAGGAAGGAGG - Intergenic
947556590 2:231098868-231098890 AAGAGGTACCACAAGGAAGGGGG - Intronic
948465338 2:238149332-238149354 CAGAGGGCCCACAGTGAAGAGGG + Intronic
948465353 2:238149376-238149398 CAGAGGGCCCACAATGAAGGGGG + Intronic
948502402 2:238405143-238405165 GACAGGGCCCATAGGGAAGAAGG + Intergenic
948818124 2:240523901-240523923 CAAAGGGACCATGCGGAGGATGG - Exonic
1169049377 20:2563037-2563059 CAGAGGGACCTTGGGGAAAACGG - Intronic
1170351131 20:15442533-15442555 TAGAGGGACCATTAGACAGAGGG - Intronic
1171078688 20:22155679-22155701 CAAAGAGACCATGAGTAAGATGG + Intergenic
1172031121 20:31982844-31982866 CAGAGGCCCCATCAGTAAGAAGG - Intronic
1172528042 20:35612542-35612564 CACAGGGCCCACACGGAAGAAGG - Intergenic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173613027 20:44384777-44384799 CAGAGAGACTATAAGTAAGGGGG + Intronic
1173873899 20:46357834-46357856 CAGAGGGGCGAAGAGGAAGAGGG - Intronic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174988157 20:55479251-55479273 CAGAGGGACCAAAAGTCAGTTGG + Intergenic
1175427772 20:58880290-58880312 CCGAGGGAAAATAAGTAAGATGG - Intronic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1178639564 21:34335166-34335188 GAGACAGACCAGAAGGAAGATGG + Intergenic
1178923579 21:36756920-36756942 AAGAAGGACAAAAAGGAAGATGG - Intronic
1178939648 21:36894411-36894433 CAGAGGGACCACGAGATAGATGG - Intronic
1180206416 21:46264153-46264175 CAGAGGGACTGTGAGGAAGTTGG - Exonic
1182737643 22:32542273-32542295 CAGAGGGGCCATTAGGAAGAAGG + Intronic
1184336070 22:43853956-43853978 CAATGGGACCTTAAGGATGAGGG + Intronic
1184687190 22:46102040-46102062 CAGCAGGGCCATCAGGAAGAGGG - Intronic
1184829683 22:46976671-46976693 AAGAGGGTGCTTAAGGAAGATGG - Intronic
950950837 3:16996548-16996570 CAGTGGGACCATAAGGGAAATGG + Intronic
951358713 3:21700250-21700272 TATAGGGACCAGAAGGAAGTGGG + Intronic
953197192 3:40745710-40745732 CAGTGAGACTTTAAGGAAGATGG - Intergenic
953266492 3:41394262-41394284 CAGAAGGACAAAGAGGAAGACGG + Intronic
953381207 3:42474070-42474092 CAGAGAGATCATAAGAAAGTGGG + Intergenic
954568984 3:51624797-51624819 GAAAGGGACCATAAGGAAACTGG + Intronic
955399482 3:58581266-58581288 CAGAGGAACCCAAAGGAAGGGGG + Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
955813289 3:62814968-62814990 GAGAGGGACCAAAAAGAAGACGG - Intronic
956158733 3:66325663-66325685 CAGAGGAATCATATGTAAGAAGG + Intronic
956626620 3:71273120-71273142 CACAAGGACCAGAAGGAAGAAGG - Intronic
956914189 3:73853452-73853474 CAGAGGAACCAAAAGGAAAAAGG + Intergenic
957370445 3:79287573-79287595 AAGAGGAACCATCTGGAAGATGG - Intronic
957955312 3:87178680-87178702 CAGAGGGAGAAGAAGGTAGAAGG - Intergenic
960044717 3:113185773-113185795 CAGAGAGATTATAAGGAACAAGG + Intergenic
961636046 3:128333635-128333657 CACAGGGCCGATATGGAAGATGG - Intronic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
962708232 3:138064871-138064893 CAGAAGGGCCAGGAGGAAGAAGG + Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
966325733 3:178751668-178751690 CAAAGGTACAATAGGGAAGAGGG + Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
969645076 4:8423377-8423399 CAGAAGGACAATATGGATGAGGG + Intronic
970484563 4:16511548-16511570 GAAAGGGAAGATAAGGAAGAAGG - Intronic
971436153 4:26626734-26626756 CAAAAAGACCATTAGGAAGAGGG - Intronic
972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG + Intergenic
974258290 4:59490534-59490556 CAGAGGAACAATAAGGACAAAGG - Intergenic
974701462 4:65453893-65453915 CCGAGGCAGCATAAGGCAGAAGG - Intronic
975988554 4:80231530-80231552 CAGTGGGAAAATAAGGCAGAGGG - Intergenic
976080761 4:81352252-81352274 CAGAGGGAGCATAAATCAGATGG + Intergenic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
977172789 4:93783741-93783763 TAGAGGGACTCTAAGCAAGAGGG - Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
980774982 4:137425936-137425958 CAGAGGTACGATAAGGATGGTGG - Intergenic
982981448 4:162141417-162141439 AAGAGGGACCAAAAGAGAGAAGG - Intronic
986297271 5:6449576-6449598 GAGAGGGAGGCTAAGGAAGAGGG - Intronic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
989136130 5:38156814-38156836 AAGAGGGAAAATATGGAAGATGG + Intergenic
990061477 5:51654913-51654935 CAGAGGAACCATAACAAAAATGG - Intergenic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991527533 5:67578236-67578258 CAGATGGACCCTAAGCCAGAGGG + Intergenic
996774381 5:127118285-127118307 CAGAGGGAGAATCACGAAGAAGG + Intergenic
999499571 5:152133123-152133145 CAGAGGGAAAATGAGGAACAAGG - Intergenic
1000442260 5:161277886-161277908 CACAGAGACCAAAAGGAAGATGG - Intergenic
1000444523 5:161303715-161303737 GAGAAGGACCATAAGGCAAAGGG - Intronic
1000590886 5:163156222-163156244 AAGAGGAAGCATAAGGAACAAGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002769050 6:273712-273734 CAGAGGGATGTCAAGGAAGATGG - Intergenic
1003492164 6:6632474-6632496 CCGAGGGACCTTGAGGCAGAGGG + Intronic
1004331794 6:14728673-14728695 CAGAGGGACCATGATGGAGGAGG - Intergenic
1005136255 6:22571496-22571518 CATAATGACCATTAGGAAGAGGG - Exonic
1005496285 6:26390925-26390947 CACAGGGACCATAGGGAACTGGG + Intronic
1007278300 6:40691611-40691633 CAGAGGGGCCACATGAAAGATGG - Intergenic
1007537375 6:42605117-42605139 GAGATGGAGCACAAGGAAGAAGG - Intronic
1008745406 6:54664161-54664183 CAGAAGGACCATAAAAAATATGG - Intergenic
1009633815 6:66236718-66236740 TAGAGTGAGTATAAGGAAGAGGG - Intergenic
1011409190 6:87048938-87048960 CAGAGGAACAACAAGTAAGAAGG + Intergenic
1011535269 6:88369859-88369881 AGGAGGGACCATTAGGATGAGGG + Intergenic
1012279741 6:97314586-97314608 CAGAAAGATCATATGGAAGAAGG - Intergenic
1012993859 6:105953483-105953505 AAGAGGAACCAAAATGAAGATGG - Intergenic
1014813820 6:125913314-125913336 CAGAGGTCTCTTAAGGAAGAAGG - Intronic
1015871383 6:137779837-137779859 AAGAGGAAACATCAGGAAGAAGG - Intergenic
1017363006 6:153598630-153598652 CAGAGTAACCATCAGCAAGAAGG - Intergenic
1019074726 6:169378115-169378137 CGGAGGTCCCTTAAGGAAGAAGG - Intergenic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1020105291 7:5419897-5419919 CTGAGAGACCCCAAGGAAGAGGG + Intronic
1020437114 7:8176296-8176318 CATGTGGACCAAAAGGAAGAGGG - Intronic
1023854770 7:44176045-44176067 CAGAGGTTCCATGAGCAAGAAGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024930574 7:54663888-54663910 CAGAGGGACATGAAGGAAGCAGG + Intergenic
1026156137 7:67827420-67827442 CTGAGGGGCCACAAGGCAGAAGG - Intergenic
1027735123 7:81922337-81922359 AAGAGGAATCATAAGAAAGAGGG - Intergenic
1027772854 7:82429378-82429400 TAGAGGCAACAGAAGGAAGAAGG + Intronic
1028116990 7:87009365-87009387 CAGACAGAACATTAGGAAGAAGG + Intronic
1029526463 7:101097607-101097629 CTTAGGGACCAGATGGAAGAGGG + Intergenic
1031371627 7:120974768-120974790 CAGAGGCACCAAAAGGCAAATGG + Exonic
1033415848 7:141160689-141160711 CAGACCCACCATAAGGAAAACGG - Intronic
1034919523 7:155068505-155068527 CAGAGGTACCATATGGCAGACGG + Exonic
1036684790 8:10902499-10902521 CAGAGGGACCAGACGGAGAAAGG - Intronic
1037077861 8:14744160-14744182 CATAGGGAGCATAAAGAAAATGG + Intronic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1039215794 8:35269313-35269335 CAGAGAGACAGGAAGGAAGATGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1040912326 8:52531645-52531667 CATAGGGACCAGACAGAAGAGGG + Intergenic
1040923876 8:52654844-52654866 AAGAGGAAACATAAGGAATAAGG - Intronic
1043081935 8:75776859-75776881 CAGAGATACCAAAAGAAAGAAGG - Intergenic
1045455589 8:102375710-102375732 TACAGGGACCAAAAGGAAGCTGG + Intronic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1046513043 8:115222646-115222668 CCGAGGGTGCATAAGGCAGAAGG - Intergenic
1048397328 8:134026503-134026525 CAAAGGGATCAGAAGGAAGTTGG - Intergenic
1048906334 8:139092920-139092942 GAGAGCGAGCATTAGGAAGAAGG - Intergenic
1049518280 8:143073593-143073615 AACAGGGACCATGAGGATGATGG - Intergenic
1049703123 8:144023966-144023988 GAGAGGGTCCTTAAGGTAGAAGG - Intronic
1051530324 9:18095002-18095024 TAGAGGGACAGGAAGGAAGAAGG - Intergenic
1052863263 9:33449723-33449745 CAGAGGGACCAAAAGAGAGAAGG + Intergenic
1054840520 9:69733505-69733527 CACAGGGTCCAAGAGGAAGATGG + Intronic
1055251144 9:74307208-74307230 CAGAGGGTTCATAAGGGAGCTGG - Intergenic
1055669884 9:78594069-78594091 CAGAGGGACAAAAATGAAGCTGG - Intergenic
1056933535 9:90898101-90898123 AAGAAGGACCATAAGGTAAAAGG - Exonic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1059535291 9:115075106-115075128 CACAGGCACTATGAGGAAGAAGG - Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059857541 9:118416588-118416610 GAGAGAGGCCATAAGGATGATGG + Intergenic
1061279632 9:129590030-129590052 GAGAGGGAACATCAGGCAGAAGG + Intergenic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1186240394 X:7559296-7559318 CAGAGGGAAAAAAAGAAAGAAGG - Intergenic
1186342317 X:8657820-8657842 AAGATGGAGAATAAGGAAGAAGG + Intronic
1187245332 X:17548804-17548826 CAGAGAGAGGAAAAGGAAGAGGG + Intronic
1189718259 X:43886613-43886635 CAATGGAACCATAAGGAAAAAGG - Intergenic
1189834292 X:45005026-45005048 AAGAGGTACCATAAGGAGGGGGG - Intronic
1189955067 X:46269507-46269529 AAGAGGAAGCATATGGAAGAAGG + Intergenic
1190008799 X:46764709-46764731 CAGAGGGAACAAAAAGAAAAGGG + Intergenic
1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG + Intergenic
1190912499 X:54786138-54786160 CAGAGTGACCATGTGGATGATGG - Intronic
1190918460 X:54827270-54827292 CAGAGTGACCATGTGGATGATGG + Intergenic
1190960427 X:55241177-55241199 GAGAGGGACCCTTAGGAGGAGGG + Intronic
1191639944 X:63419632-63419654 CATAGGTACCATAAAGAAGTTGG + Intergenic
1192144472 X:68672229-68672251 CAGATTGGCCTTAAGGAAGAAGG - Intronic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1194979777 X:100428444-100428466 CGTAGAGGCCATAAGGAAGAAGG - Intergenic
1195755987 X:108199087-108199109 CAGAGGGGCCAAGAGAAAGAAGG + Intronic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1197926113 X:131648072-131648094 TAGAGAGACCACTAGGAAGAGGG - Intergenic
1198040582 X:132847675-132847697 CAGAGGGACCAAAAGGGAGAGGG + Intronic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1201146605 Y:11068095-11068117 GAGAGGGAGAAGAAGGAAGAGGG + Intergenic