ID: 978339745

View in Genome Browser
Species Human (GRCh38)
Location 4:107709713-107709735
Sequence TAGTGTGTTAAGTACACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978339745_978339751 21 Left 978339745 4:107709713-107709735 CCAGAAGTGTACTTAACACACTA 0: 1
1: 0
2: 0
3: 10
4: 91
Right 978339751 4:107709757-107709779 TGATTACATCCCCAACGAACTGG 0: 1
1: 0
2: 2
3: 8
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978339745 Original CRISPR TAGTGTGTTAAGTACACTTC TGG (reversed) Intronic
900578300 1:3394981-3395003 TAGTGTGTGAAGTTCCCTTATGG - Intronic
910007565 1:82417303-82417325 TAGTGTGCTATATACACTTCAGG + Intergenic
911742157 1:101398471-101398493 CAGTGTATTTAGTACACTGCTGG - Intergenic
915069657 1:153255671-153255693 TAGGGTGTTAAGGACACATTGGG - Intergenic
916279621 1:163035221-163035243 TATTTTATTAAGTACACTGCTGG + Intergenic
917529347 1:175820446-175820468 TGTTGTATTAAGTACACTTCTGG + Intergenic
918075906 1:181171358-181171380 TTGTGTGTTGAGTCCACCTCTGG + Intergenic
922978533 1:229805049-229805071 TTGTGTGTTGAGTCCACTTCTGG + Intergenic
923277778 1:232413881-232413903 TAGTGTGTAAAGAACACCCCAGG + Intronic
1066300173 10:34089348-34089370 TAGTGAGTCAAGAACATTTCAGG + Intergenic
1069752932 10:70756054-70756076 TATTTTGGTAAGTACAGTTCAGG - Intronic
1071324954 10:84504732-84504754 TAATGTCTTAAGTACTTTTCTGG + Intronic
1077927096 11:6692474-6692496 AAGTGTGTAAAGTATACTCCTGG + Intergenic
1078361480 11:10671756-10671778 TATTTTGTTAAGTATATTTCTGG - Intronic
1080729271 11:34932202-34932224 TAGGGTGTTTATTCCACTTCCGG - Intronic
1081089020 11:38839128-38839150 AAATGTGTTAAGTAACCTTCTGG + Intergenic
1085886590 11:80530087-80530109 TATAATGTTAAGTGCACTTCAGG - Intergenic
1086068138 11:82768331-82768353 TAGTGTGTTACATACACCTAAGG + Intergenic
1092942700 12:13425213-13425235 TGGTGTGTTAAGCACACTACAGG + Intergenic
1097470196 12:59981010-59981032 TCATGTGTTCAGCACACTTCAGG - Intergenic
1100809287 12:98322742-98322764 ATGTGTGTTCAGTACATTTCAGG + Intergenic
1101546251 12:105716076-105716098 TTCTGTGTTCAGGACACTTCAGG + Intergenic
1109567613 13:64138051-64138073 TGGTGTGTTAACTACTCTTAAGG + Intergenic
1109734095 13:66458228-66458250 TAGTGATTTAAGTAGATTTCTGG + Intronic
1109778751 13:67079155-67079177 TAGTGTATTTAGTATATTTCAGG - Intronic
1112228663 13:97566196-97566218 GTGTGTGTTAATTCCACTTCTGG - Intergenic
1112876095 13:104040547-104040569 TAGTATTTTAAGTATTCTTCTGG - Intergenic
1116201596 14:41804306-41804328 TAGTGTACCAAGTTCACTTCTGG + Intronic
1119948657 14:78721639-78721661 TGGTGTACTGAGTACACTTCAGG + Intronic
1124258720 15:28167156-28167178 AAGTGTGTTAAGTACTCATGGGG - Intronic
1126226053 15:46271159-46271181 TAGTGAGTTCAGTACTATTCAGG - Intergenic
1132889918 16:2198686-2198708 TTGTGTGTTAAGCACAGGTCAGG - Intergenic
1138731800 16:59203720-59203742 TAGTGTGATAAGCACAATTATGG + Intergenic
1146021409 17:29282103-29282125 TTGAGTGTTAAGTACAATTGAGG - Intronic
1146133792 17:30300500-30300522 TTGTGTGTTGAGTCTACTTCTGG + Intergenic
1154149949 18:11898721-11898743 TTGTGTGCTGAGTCCACTTCTGG - Intronic
1156418396 18:36923882-36923904 TAATGTGTTTAGGAAACTTCAGG + Intronic
1159536862 18:69725786-69725808 GAGTATTTTAAATACACTTCAGG - Intronic
1163146508 19:15382953-15382975 TGGTGTGTTTTGTACATTTCTGG - Intronic
1166592646 19:44014624-44014646 TTGTGCATTAAGTCCACTTCTGG + Intergenic
1168431531 19:56285112-56285134 TAGAGTCTAAAGAACACTTCAGG + Intronic
930300476 2:49609627-49609649 TTGTGTGTGAAGAAGACTTCAGG + Intergenic
931143135 2:59485697-59485719 GACTATGTTAAGTTCACTTCAGG + Intergenic
933358329 2:81243732-81243754 AAGTGTGTTAAATAGACTTGAGG + Intergenic
940454411 2:153877858-153877880 TACTGTGGTAAGTAAACATCTGG + Intronic
940739092 2:157486368-157486390 GACTTTGTTAAGTACACTTTAGG - Intronic
941459272 2:165748475-165748497 TTGTGTGTTTTGTACACTTAGGG - Exonic
942241251 2:173965171-173965193 TAGTGTGTTTAGGGCACCTCAGG + Exonic
943343395 2:186708501-186708523 TAGTGTGATAAGTATATTTGAGG + Intronic
944647233 2:201792077-201792099 TAAGGTGTTAAGTAGAGTTCAGG + Intronic
945400080 2:209370771-209370793 TAGTCTGTTAGGTAAACTTTGGG - Intergenic
949081737 2:242106123-242106145 TAGACTTTTAAGTACAGTTCAGG - Intergenic
1174846789 20:53950254-53950276 TAGTGAGCTTAGTACATTTCAGG - Intronic
1184589723 22:45473812-45473834 GAGTGTGCTAAGGACACTTGTGG - Intergenic
950319528 3:12037224-12037246 TAGAGTCTTAAGGACAATTCTGG - Intronic
950636314 3:14317613-14317635 TACTGTGTTAAGTGCTCTGCAGG + Intergenic
951240498 3:20280978-20281000 TAGGTTTTTAAGTACACATCAGG - Intergenic
951982529 3:28581401-28581423 TAGTGTCTTAGGCATACTTCTGG - Intergenic
952589857 3:34938231-34938253 TTTTGTGTTAAGTACAATTCAGG + Intergenic
957278835 3:78123974-78123996 TAGTGTTTTCAGTATACTTTTGG + Intergenic
959317873 3:104832182-104832204 AAGTGTGCTAAGCACACTTAAGG - Intergenic
961106121 3:124243138-124243160 TAGTGTCAGAAGTACAATTCTGG + Intronic
969981411 4:11160025-11160047 CAGTGTGTAAAGTACACTCAGGG - Intergenic
975450759 4:74523396-74523418 GAGTGTGATAACTACTCTTCAGG + Intergenic
976480070 4:85532233-85532255 TAGTGTTTTACTTAGACTTCTGG + Intronic
977355837 4:95945030-95945052 TAGTATTTTTAATACACTTCTGG - Intergenic
978339745 4:107709713-107709735 TAGTGTGTTAAGTACACTTCTGG - Intronic
978526840 4:109676137-109676159 CAGAGTGTTAAGGACAATTCTGG + Intronic
984568902 4:181366097-181366119 TAGTCTTCTGAGTACACTTCTGG - Intergenic
986277290 5:6287726-6287748 TAGTATGTTAAGAACACTAGTGG + Intergenic
987505847 5:18770767-18770789 TAGTGTTTTAAGTTCACTTTTGG - Intergenic
987666599 5:20949911-20949933 CAGTTTGTCAATTACACTTCAGG + Intergenic
989232235 5:39099670-39099692 AAATGTGTTTAGTACAGTTCTGG - Intergenic
993710347 5:91217943-91217965 TTGTGTGTTAAATACACCTTAGG + Intergenic
997943353 5:138178343-138178365 TAGTGTGTTAGGAACTCTGCGGG - Intronic
1001826986 5:174752980-174753002 TGGTGTGTTCTATACACTTCAGG - Intergenic
1003965725 6:11250449-11250471 CTGTGTGTTAAGAACACTTGAGG - Intronic
1007472554 6:42100249-42100271 TAGTGTGTAAAATGCACTTGCGG + Intergenic
1007515464 6:42407093-42407115 TGGTGTGTTTAGGACACTTTGGG - Intronic
1011563048 6:88643115-88643137 AAGTGTCTTAAGCACACTTAAGG - Intronic
1012186146 6:96219473-96219495 TTCTGTGCTAAGTACACTTTGGG + Intergenic
1012332620 6:98011785-98011807 TAGTTTATTAATTACAGTTCTGG + Intergenic
1015756515 6:136612044-136612066 TTGTGTGTTGAGTCCACTTCTGG - Intronic
1017917237 6:158840918-158840940 TCTTGTGCTAAGTCCACTTCAGG + Intergenic
1021859670 7:24893907-24893929 TAGTGTGTTAAATAAAGTCCTGG - Intronic
1021949289 7:25759146-25759168 TCGTGTTTATAGTACACTTCTGG + Intergenic
1024970508 7:55065407-55065429 TAGTGAGTAAATTACTCTTCTGG - Intronic
1026402371 7:70027536-70027558 TAGTGTCTTAAGTTTAGTTCAGG - Intronic
1030916976 7:115327372-115327394 TAGTTTGATGAGTACCCTTCAGG + Intergenic
1031478574 7:122251569-122251591 TAATGTGTTAAGTTCAATTCAGG + Intergenic
1031704629 7:124964489-124964511 TAGTTTCTTAATTACCCTTCTGG + Intergenic
1035539649 8:422912-422934 TAGACTTTTAAGTACAGTTCAGG - Intronic
1036117661 8:5976054-5976076 TATTGTGGTAAGAACACTTAAGG - Intergenic
1043944791 8:86237837-86237859 TAGTGTGCCAAATCCACTTCTGG - Intronic
1043991906 8:86765670-86765692 TCGTGTGCTGAGTCCACTTCTGG - Intergenic
1045386693 8:101678036-101678058 TAAAGTGTTCAGCACACTTCCGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060502541 9:124172810-124172832 TAGTGTGTTAAATAAAATTGTGG - Intergenic
1060606181 9:124916186-124916208 TATTGTGTTAAGTACAATACAGG + Intronic
1193530928 X:82653018-82653040 AAGTGTGTTAAATACAATTTGGG + Intergenic
1195328786 X:103779672-103779694 CAGCCTGTTAAGTAAACTTCTGG - Intronic
1195701060 X:107706109-107706131 TAGTGAGTTAAGTTCACATCTGG - Intergenic