ID: 978339808

View in Genome Browser
Species Human (GRCh38)
Location 4:107710340-107710362
Sequence CAGTGTAAGTATGTGTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978339808 Original CRISPR CAGTGTAAGTATGTGTACCT AGG Intronic
900136245 1:1118293-1118315 CAGTGCATGTGTGTGTGCCTCGG + Intergenic
900210913 1:1455516-1455538 TAGTGTAAGTCGGTGTGCCTGGG + Exonic
900216736 1:1485835-1485857 TAGTGTAAGTCGGTGTGCCTGGG + Exonic
900223818 1:1523564-1523586 CAGTGTAAGTCGGTGTGCCTGGG + Exonic
901395170 1:8975861-8975883 CAGTGTAAGAATCTCTTCCTAGG - Intergenic
903620386 1:24693905-24693927 CAGTGGAAGGATGAGTACCATGG - Intergenic
907244459 1:53099361-53099383 CAGGGTATGTGTGTGTACCGAGG - Intronic
907877007 1:58500336-58500358 CAGTGTATGTTTGTGTACACTGG + Intronic
909793613 1:79704532-79704554 CAGTGAAAGTATCTGGTCCTTGG + Intergenic
911740375 1:101380464-101380486 CAGTGGAAGAATTTGTACATAGG - Intergenic
915797282 1:158750419-158750441 CAGAGTAAGAATTTGAACCTAGG - Intergenic
916314728 1:163436668-163436690 GTGTGTGAGTGTGTGTACCTTGG + Intergenic
919092286 1:192990506-192990528 CAGTGTAAGTATATGAAAATAGG - Intergenic
923111830 1:230897000-230897022 CAGAGTAAGTATTTGTCACTGGG + Intergenic
923488367 1:234458825-234458847 CAGTGAAAGTCTGTCTACCAGGG + Intronic
924006061 1:239612835-239612857 CAGTGGTAGTGTGTGAACCTGGG - Intronic
924221462 1:241879912-241879934 CAGGGTAATTATTTGAACCTGGG + Intronic
1066481578 10:35800323-35800345 CAGTTTACGTAAGTTTACCTTGG - Intergenic
1067465628 10:46496879-46496901 CAGTGTAATTATGTCTTCCTGGG + Intergenic
1067621559 10:47887727-47887749 CAGTGTAATTATGTCTTCCTGGG - Intergenic
1067765080 10:49079362-49079384 AAATGTAAGTATATGTAGCTGGG - Intronic
1069952780 10:72031119-72031141 CACTGGAAGGATGAGTACCTGGG - Intergenic
1072156631 10:92729850-92729872 CAGTGTGAGGATTTGAACCTGGG + Intergenic
1075153983 10:119958807-119958829 CAGGGTAACCGTGTGTACCTGGG - Intergenic
1077155994 11:1091296-1091318 CTGTGTAACTGTGTGTGCCTGGG - Intergenic
1077156008 11:1091601-1091623 CTGTGTAACTGTGTGTGCCTGGG - Intergenic
1078774247 11:14379767-14379789 CAGTGTGAGTATGCATTCCTGGG + Intergenic
1078877066 11:15409538-15409560 TAGTGTAAATGTGTGTACATAGG + Intergenic
1086251383 11:84819030-84819052 CAGTGTATGTATGTGTAAAAAGG - Intronic
1087209804 11:95435689-95435711 TAGTGTAAGTATGTGCACCATGG + Intergenic
1093056417 12:14560540-14560562 CAGTATACCTCTGTGTACCTTGG + Intronic
1093293517 12:17359124-17359146 AAGTTTAAGAATGAGTACCTAGG + Intergenic
1093608750 12:21128133-21128155 CAGTGGAAGCATGTGGATCTAGG + Intronic
1093798828 12:23346773-23346795 CAGTGTAAGTAGCTGTGCCAAGG - Intergenic
1094814995 12:34174285-34174307 CAATGTTAATATGAGTACCTAGG - Intergenic
1096761159 12:53843166-53843188 CTGTGTATGTGTGTGTACATTGG + Intergenic
1099623752 12:85039287-85039309 CAGTGTAAGTATTATTACCAGGG + Intronic
1100108042 12:91202168-91202190 CACTGCAAATATGTGTACATTGG + Intergenic
1100294986 12:93252706-93252728 CCTTTTAAGTATGTATACCTTGG + Intergenic
1100761605 12:97813353-97813375 CAGTGTAAGTATGTGAAGTTTGG - Intergenic
1103013015 12:117472173-117472195 CAGTGGAAGGATGTTTATCTGGG + Intronic
1104883266 12:132086995-132087017 CAGAGTAATTTTTTGTACCTTGG + Intronic
1105298545 13:19112639-19112661 CAGTTTAATTATGTGTAATTTGG - Intergenic
1108223467 13:48263095-48263117 AAGTGTAAGTTTGGGTCCCTGGG - Exonic
1108691603 13:52864018-52864040 CAGAGTTAGTCTGTGGACCTAGG + Intergenic
1113806826 13:113114895-113114917 CAGTGTAAGAATGTGGTCTTGGG - Intronic
1117374066 14:55104790-55104812 CAGAGTTAGGATGTGAACCTAGG + Intergenic
1119766129 14:77188927-77188949 CAGTTAAACTATGTGTAACTGGG + Intronic
1123175339 14:106411182-106411204 CAGTGTATGTATGTGAAGTTTGG + Intergenic
1126100208 15:45114167-45114189 CAGTGTGAGCATCTGGACCTAGG + Intronic
1131817125 15:96233590-96233612 CGGTGGAAGGATGTGAACCTGGG - Intergenic
1135394879 16:22123532-22123554 GAGGGGAAGTACGTGTACCTGGG - Intronic
1136610120 16:31361127-31361149 CACTTTAAATATGTGTTCCTGGG - Exonic
1143573827 17:7778119-7778141 CAGTATAATTATGAGTACTTGGG + Exonic
1143845633 17:9771198-9771220 CAGTGTGAGTGTGTGTATGTGGG + Intergenic
1159722631 18:71911981-71912003 CAGTGTATCTATCTTTACCTAGG + Intergenic
1165231183 19:34387973-34387995 CATTGTAGGTGTTTGTACCTGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
933388081 2:81636843-81636865 CAGTGTATGTATGTCTTCATAGG - Intergenic
938943796 2:136192293-136192315 CAGTGGAAGTATTTATACCATGG + Intergenic
939375081 2:141354660-141354682 AAGTGGAAATACGTGTACCTCGG + Intronic
940153341 2:150627146-150627168 CAGTGTATGTATTTGTACCATGG + Intergenic
940480756 2:154227689-154227711 CAGGGTGTTTATGTGTACCTGGG + Intronic
941241484 2:163044100-163044122 CAGTGTCAGTACGGGCACCTGGG - Intergenic
945350356 2:208770946-208770968 TAGAGTATGTGTGTGTACCTTGG + Intronic
945543729 2:211122992-211123014 GTGTGTATGTATGTGTGCCTGGG + Intergenic
946491934 2:220157040-220157062 CTGTGTATGTCTGTGTACATTGG + Intergenic
1169133826 20:3183947-3183969 CAGTGCAAGGATGAGTATCTGGG - Intergenic
1175282922 20:57816489-57816511 CCATGTCAGGATGTGTACCTTGG + Intergenic
1177498404 21:21918487-21918509 CAGTATAAGGCTGTGTTCCTGGG + Intergenic
1179939827 21:44630045-44630067 CACTGTGAGTGTGTGTACCACGG - Intronic
1180172824 21:46068822-46068844 CTGTGTGAGCATGTGTGCCTGGG + Intergenic
1184740319 22:46424524-46424546 CTGTGTCAGTGTTTGTACCTGGG - Intronic
950367716 3:12499848-12499870 CAGGGTCAGTATGTGGACTTAGG + Intronic
951072023 3:18340305-18340327 CAGTCTATGTTTGTGTTCCTAGG - Intronic
951991577 3:28681039-28681061 CTGTATATGTATGTGTATCTAGG + Intergenic
953498390 3:43408727-43408749 CAGTGTAAAAGTGTTTACCTTGG + Intronic
958461297 3:94399699-94399721 CAATGTGAGTATTTGTACATAGG - Intergenic
960338136 3:116443728-116443750 CAGTGTCAGTCTGTCTATCTAGG - Intronic
963182493 3:142373528-142373550 TAATGTAAGGATGTGTGCCTTGG - Intronic
967273524 3:187750860-187750882 CTGTGTGTATATGTGTACCTGGG + Intergenic
970648879 4:18156010-18156032 CTGTGTAAGTGTGTGCACATAGG - Intergenic
972825277 4:42751184-42751206 CAGACTAAGTATGTGCAACTTGG - Intergenic
974609075 4:64191789-64191811 CAGTCTAAGTGTGTGTTTCTAGG + Intergenic
978271145 4:106892778-106892800 TAGCATAAGTATGTGTCCCTGGG - Intergenic
978339808 4:107710340-107710362 CAGTGTAAGTATGTGTACCTAGG + Intronic
980178009 4:129370521-129370543 CTGTGTAAATATGTCTGCCTAGG - Intergenic
981529181 4:145735346-145735368 CAATGTGAGGATGTGTGCCTGGG - Intronic
982285113 4:153725930-153725952 CAGTGTAAGTCTGGGTAGCAAGG - Intronic
982921537 4:161280060-161280082 CAATGTAATTATCTGTAACTTGG + Intergenic
985255089 4:188062139-188062161 AAGTGTAAGTATGTGAACATTGG + Intergenic
985958228 5:3280547-3280569 CTGTGTATGCATGTGTGCCTAGG - Intergenic
986343715 5:6814959-6814981 AAGTGTCATTAGGTGTACCTGGG + Intergenic
986791533 5:11166184-11166206 GAGTGACAGTTTGTGTACCTGGG + Intronic
987823929 5:23003769-23003791 CAGTGAAAGGATGTGTAGCAGGG + Intergenic
988996458 5:36719605-36719627 CAGTGTGAGAATGTATATCTAGG - Intergenic
989970134 5:50513753-50513775 CAGAGTAAGTATAAGTACATTGG - Intergenic
991527873 5:67582683-67582705 CTGTGTCAGTTTGTGTAGCTTGG - Intergenic
992147912 5:73870667-73870689 CAGTGTGAGTAGCTGCACCTGGG + Intronic
992987234 5:82244325-82244347 CAGTGTAAGTGTGTGGTCTTAGG + Intronic
993144009 5:84070856-84070878 CAGTGTATGTTTGTGTAGCTGGG + Intronic
995411322 5:111860172-111860194 CAGTGTGAGTATGTGTACTTGGG + Intronic
996434245 5:123416476-123416498 CAGGGGAATTATGTGAACCTGGG + Intronic
997414697 5:133716923-133716945 CAGTCCAAGTATTTGTCCCTTGG + Intergenic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
998238833 5:140424155-140424177 CAGTGGAAGTATATATACCAGGG - Intronic
1006885847 6:37381573-37381595 GAGGCTAAGTATGTGTGCCTTGG + Intronic
1009985638 6:70778708-70778730 CAGTGTCAGTCTGAGTACGTCGG + Intronic
1011026698 6:82877454-82877476 GAGTGCAAGGATGTTTACCTTGG - Intergenic
1014632731 6:123806240-123806262 CAATCTAAGTAAGTGTACATTGG + Intronic
1016591162 6:145745224-145745246 CAATATAATTAGGTGTACCTGGG + Intergenic
1020960127 7:14792073-14792095 CAGTGAAACCATGTGTGCCTAGG + Intronic
1021271428 7:18591707-18591729 CAGGCTAAGGATGTGTACCCAGG - Intronic
1024897477 7:54277135-54277157 CAGTATAAATATGTTTACTTTGG - Intergenic
1027353995 7:77338998-77339020 CAGAGTAAATAGGGGTACCTTGG + Intronic
1035944100 8:3940531-3940553 GTGTGTATGTATGTGTACATAGG + Intronic
1043487698 8:80714626-80714648 CAATGTAAATATGTGAAGCTAGG - Intronic
1043799779 8:84593642-84593664 CAGTGTAAATCTCTGTACATAGG + Intronic
1045223228 8:100218865-100218887 CAGTGTTTGTATGTGTACTGCGG + Intronic
1045327752 8:101129266-101129288 AAATGTAAAAATGTGTACCTGGG - Intergenic
1047299555 8:123601415-123601437 CAGTGTATGTATTTGTAGGTGGG + Intergenic
1048813424 8:138309148-138309170 CAGTGTCCATATGTGTACATTGG - Intronic
1051840334 9:21389912-21389934 CAGTGAAACCATGTGTCCCTGGG - Intergenic
1058865086 9:109154582-109154604 CAATTTAATTCTGTGTACCTAGG - Intronic
1061900575 9:133670009-133670031 CAGTGTAAGGTTGCGCACCTGGG - Intronic
1062001907 9:134220372-134220394 CAGTGCCAGTCTGTGTACCCTGG + Intergenic
1187321630 X:18243976-18243998 CATTTTAAGTATATTTACCTAGG + Intronic
1187613447 X:20967957-20967979 CAGTGTAAATATTTTCACCTTGG + Intergenic
1188588470 X:31804794-31804816 AAGGATAAGTAGGTGTACCTAGG - Intronic
1195218467 X:102723221-102723243 CAGTGTAAGAAAGTGTTGCTAGG + Intronic
1199295858 X:146157950-146157972 GAGAGTAAGTATGTGTACTTGGG + Intergenic
1200827558 Y:7659907-7659929 CTGTGTACCTTTGTGTACCTTGG + Intergenic
1200884377 Y:8253509-8253531 CTGTGTACCTTTGTGTACCTTGG + Intergenic
1200957990 Y:8970673-8970695 CTGTGTACCTTTGTGTACCTTGG - Intergenic
1202107324 Y:21384931-21384953 CTGTGTACCTTTGTGTACCTTGG + Intronic
1202124268 Y:21554980-21555002 CTGTGTACCTTTGTGTACCTTGG - Intergenic
1202154740 Y:21874400-21874422 CTGTGTACCTTTGTGTACCTTGG + Intergenic
1202199622 Y:22332195-22332217 CTGTGTACCTTTGTGTACCTTGG - Intronic