ID: 978341589

View in Genome Browser
Species Human (GRCh38)
Location 4:107725541-107725563
Sequence GACAGCTTGTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978341589_978341592 2 Left 978341589 4:107725541-107725563 CCAGTAACAGGCCACAAGCTGTC No data
Right 978341592 4:107725566-107725588 TCAAAAGGAGAGTAGTTATCTGG 0: 5
1: 16
2: 4
3: 16
4: 163
978341589_978341593 15 Left 978341589 4:107725541-107725563 CCAGTAACAGGCCACAAGCTGTC No data
Right 978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG No data
978341589_978341594 16 Left 978341589 4:107725541-107725563 CCAGTAACAGGCCACAAGCTGTC No data
Right 978341594 4:107725580-107725602 GTTATCTGGAGAATATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978341589 Original CRISPR GACAGCTTGTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr