ID: 978341593

View in Genome Browser
Species Human (GRCh38)
Location 4:107725579-107725601
Sequence AGTTATCTGGAGAATATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978341588_978341593 16 Left 978341588 4:107725540-107725562 CCCAGTAACAGGCCACAAGCTGT No data
Right 978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG No data
978341587_978341593 22 Left 978341587 4:107725534-107725556 CCAAAGCCCAGTAACAGGCCACA No data
Right 978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG No data
978341591_978341593 4 Left 978341591 4:107725552-107725574 CCACAAGCTGTCTCTCAAAAGGA No data
Right 978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG No data
978341589_978341593 15 Left 978341589 4:107725541-107725563 CCAGTAACAGGCCACAAGCTGTC No data
Right 978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG No data
978341586_978341593 25 Left 978341586 4:107725531-107725553 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978341593 Original CRISPR AGTTATCTGGAGAATATGTC AGG Intergenic
No off target data available for this crispr