ID: 978343630

View in Genome Browser
Species Human (GRCh38)
Location 4:107742635-107742657
Sequence TAAGTTGGTCTCCAACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343630_978343640 27 Left 978343630 4:107742635-107742657 CCCAGAAGTTGGAGACCAACTTA No data
Right 978343640 4:107742685-107742707 AAAATATGCAAAAATTGGCTGGG No data
978343630_978343639 26 Left 978343630 4:107742635-107742657 CCCAGAAGTTGGAGACCAACTTA No data
Right 978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG No data
978343630_978343638 22 Left 978343630 4:107742635-107742657 CCCAGAAGTTGGAGACCAACTTA No data
Right 978343638 4:107742680-107742702 TCTACAAAATATGCAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343630 Original CRISPR TAAGTTGGTCTCCAACTTCT GGG (reversed) Intergenic
No off target data available for this crispr