ID: 978343631

View in Genome Browser
Species Human (GRCh38)
Location 4:107742636-107742658
Sequence CTAAGTTGGTCTCCAACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343631_978343638 21 Left 978343631 4:107742636-107742658 CCAGAAGTTGGAGACCAACTTAG No data
Right 978343638 4:107742680-107742702 TCTACAAAATATGCAAAAATTGG No data
978343631_978343639 25 Left 978343631 4:107742636-107742658 CCAGAAGTTGGAGACCAACTTAG No data
Right 978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG No data
978343631_978343640 26 Left 978343631 4:107742636-107742658 CCAGAAGTTGGAGACCAACTTAG No data
Right 978343640 4:107742685-107742707 AAAATATGCAAAAATTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343631 Original CRISPR CTAAGTTGGTCTCCAACTTC TGG (reversed) Intergenic
No off target data available for this crispr