ID: 978343632

View in Genome Browser
Species Human (GRCh38)
Location 4:107742650-107742672
Sequence TTTCTTCATGTTGGCTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343632_978343642 20 Left 978343632 4:107742650-107742672 CCAACTTAGCCAACATGAAGAAA No data
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879
978343632_978343640 12 Left 978343632 4:107742650-107742672 CCAACTTAGCCAACATGAAGAAA No data
Right 978343640 4:107742685-107742707 AAAATATGCAAAAATTGGCTGGG No data
978343632_978343639 11 Left 978343632 4:107742650-107742672 CCAACTTAGCCAACATGAAGAAA No data
Right 978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG No data
978343632_978343641 17 Left 978343632 4:107742650-107742672 CCAACTTAGCCAACATGAAGAAA No data
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060
978343632_978343638 7 Left 978343632 4:107742650-107742672 CCAACTTAGCCAACATGAAGAAA No data
Right 978343638 4:107742680-107742702 TCTACAAAATATGCAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343632 Original CRISPR TTTCTTCATGTTGGCTAAGT TGG (reversed) Intergenic
No off target data available for this crispr