ID: 978343633

View in Genome Browser
Species Human (GRCh38)
Location 4:107742659-107742681
Sequence GAGAGGGGGTTTCTTCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292588
Summary {0: 11, 1: 745, 2: 21376, 3: 113440, 4: 157016}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343633_978343640 3 Left 978343633 4:107742659-107742681 CCAACATGAAGAAACCCCCTCTC 0: 11
1: 745
2: 21376
3: 113440
4: 157016
Right 978343640 4:107742685-107742707 AAAATATGCAAAAATTGGCTGGG No data
978343633_978343641 8 Left 978343633 4:107742659-107742681 CCAACATGAAGAAACCCCCTCTC 0: 11
1: 745
2: 21376
3: 113440
4: 157016
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060
978343633_978343638 -2 Left 978343633 4:107742659-107742681 CCAACATGAAGAAACCCCCTCTC 0: 11
1: 745
2: 21376
3: 113440
4: 157016
Right 978343638 4:107742680-107742702 TCTACAAAATATGCAAAAATTGG No data
978343633_978343639 2 Left 978343633 4:107742659-107742681 CCAACATGAAGAAACCCCCTCTC 0: 11
1: 745
2: 21376
3: 113440
4: 157016
Right 978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG No data
978343633_978343642 11 Left 978343633 4:107742659-107742681 CCAACATGAAGAAACCCCCTCTC 0: 11
1: 745
2: 21376
3: 113440
4: 157016
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343633 Original CRISPR GAGAGGGGGTTTCTTCATGT TGG (reversed) Intergenic
Too many off-targets to display for this crispr