ID: 978343637

View in Genome Browser
Species Human (GRCh38)
Location 4:107742676-107742698
Sequence TTTTTGCATATTTTGTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343637_978343646 25 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343646 4:107742724-107742746 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
978343637_978343644 22 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343644 4:107742721-107742743 ACCTGTAGTCCCAGCTACTCGGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
978343637_978343641 -9 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060
978343637_978343643 21 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343643 4:107742720-107742742 CACCTGTAGTCCCAGCTACTCGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
978343637_978343642 -6 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343637 Original CRISPR TTTTTGCATATTTTGTAGAG AGG (reversed) Intergenic
No off target data available for this crispr