ID: 978343638

View in Genome Browser
Species Human (GRCh38)
Location 4:107742680-107742702
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343633_978343638 -2 Left 978343633 4:107742659-107742681 CCAACATGAAGAAACCCCCTCTC 0: 11
1: 745
2: 21376
3: 113440
4: 157016
Right 978343638 4:107742680-107742702 TCTACAAAATATGCAAAAATTGG No data
978343631_978343638 21 Left 978343631 4:107742636-107742658 CCAGAAGTTGGAGACCAACTTAG No data
Right 978343638 4:107742680-107742702 TCTACAAAATATGCAAAAATTGG No data
978343632_978343638 7 Left 978343632 4:107742650-107742672 CCAACTTAGCCAACATGAAGAAA No data
Right 978343638 4:107742680-107742702 TCTACAAAATATGCAAAAATTGG No data
978343630_978343638 22 Left 978343630 4:107742635-107742657 CCCAGAAGTTGGAGACCAACTTA No data
Right 978343638 4:107742680-107742702 TCTACAAAATATGCAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr