ID: 978343641

View in Genome Browser
Species Human (GRCh38)
Location 4:107742690-107742712
Sequence ATGCAAAAATTGGCTGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195263
Summary {0: 6, 1: 792, 2: 20300, 3: 71105, 4: 103060}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343632_978343641 17 Left 978343632 4:107742650-107742672 CCAACTTAGCCAACATGAAGAAA No data
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060
978343637_978343641 -9 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060
978343636_978343641 -8 Left 978343636 4:107742675-107742697 CCCTCTCTACAAAATATGCAAAA 0: 9
1: 599
2: 14616
3: 223566
4: 146275
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060
978343635_978343641 -7 Left 978343635 4:107742674-107742696 CCCCTCTCTACAAAATATGCAAA No data
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060
978343633_978343641 8 Left 978343633 4:107742659-107742681 CCAACATGAAGAAACCCCCTCTC 0: 11
1: 745
2: 21376
3: 113440
4: 157016
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060
978343634_978343641 -6 Left 978343634 4:107742673-107742695 CCCCCTCTCTACAAAATATGCAA No data
Right 978343641 4:107742690-107742712 ATGCAAAAATTGGCTGGGCGTGG 0: 6
1: 792
2: 20300
3: 71105
4: 103060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343641 Original CRISPR ATGCAAAAATTGGCTGGGCG TGG Intergenic
Too many off-targets to display for this crispr