ID: 978343642

View in Genome Browser
Species Human (GRCh38)
Location 4:107742693-107742715
Sequence CAAAAATTGGCTGGGCGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 469361
Summary {0: 237, 1: 18097, 2: 82197, 3: 154951, 4: 213879}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343636_978343642 -5 Left 978343636 4:107742675-107742697 CCCTCTCTACAAAATATGCAAAA 0: 9
1: 599
2: 14616
3: 223566
4: 146275
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879
978343632_978343642 20 Left 978343632 4:107742650-107742672 CCAACTTAGCCAACATGAAGAAA No data
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879
978343634_978343642 -3 Left 978343634 4:107742673-107742695 CCCCCTCTCTACAAAATATGCAA No data
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879
978343637_978343642 -6 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879
978343635_978343642 -4 Left 978343635 4:107742674-107742696 CCCCTCTCTACAAAATATGCAAA No data
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879
978343633_978343642 11 Left 978343633 4:107742659-107742681 CCAACATGAAGAAACCCCCTCTC 0: 11
1: 745
2: 21376
3: 113440
4: 157016
Right 978343642 4:107742693-107742715 CAAAAATTGGCTGGGCGTGGTGG 0: 237
1: 18097
2: 82197
3: 154951
4: 213879

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343642 Original CRISPR CAAAAATTGGCTGGGCGTGG TGG Intergenic
Too many off-targets to display for this crispr