ID: 978343643

View in Genome Browser
Species Human (GRCh38)
Location 4:107742720-107742742
Sequence CACCTGTAGTCCCAGCTACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 580448
Summary {0: 27099, 1: 99923, 2: 128146, 3: 148395, 4: 176885}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343637_978343643 21 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343643 4:107742720-107742742 CACCTGTAGTCCCAGCTACTCGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
978343636_978343643 22 Left 978343636 4:107742675-107742697 CCCTCTCTACAAAATATGCAAAA 0: 9
1: 599
2: 14616
3: 223566
4: 146275
Right 978343643 4:107742720-107742742 CACCTGTAGTCCCAGCTACTCGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
978343635_978343643 23 Left 978343635 4:107742674-107742696 CCCCTCTCTACAAAATATGCAAA No data
Right 978343643 4:107742720-107742742 CACCTGTAGTCCCAGCTACTCGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
978343634_978343643 24 Left 978343634 4:107742673-107742695 CCCCCTCTCTACAAAATATGCAA No data
Right 978343643 4:107742720-107742742 CACCTGTAGTCCCAGCTACTCGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343643 Original CRISPR CACCTGTAGTCCCAGCTACT CGG Intergenic
Too many off-targets to display for this crispr