ID: 978343644

View in Genome Browser
Species Human (GRCh38)
Location 4:107742721-107742743
Sequence ACCTGTAGTCCCAGCTACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 765008
Summary {0: 27977, 1: 146191, 2: 244935, 3: 217028, 4: 128877}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343635_978343644 24 Left 978343635 4:107742674-107742696 CCCCTCTCTACAAAATATGCAAA No data
Right 978343644 4:107742721-107742743 ACCTGTAGTCCCAGCTACTCGGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
978343637_978343644 22 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343644 4:107742721-107742743 ACCTGTAGTCCCAGCTACTCGGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
978343634_978343644 25 Left 978343634 4:107742673-107742695 CCCCCTCTCTACAAAATATGCAA No data
Right 978343644 4:107742721-107742743 ACCTGTAGTCCCAGCTACTCGGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
978343636_978343644 23 Left 978343636 4:107742675-107742697 CCCTCTCTACAAAATATGCAAAA 0: 9
1: 599
2: 14616
3: 223566
4: 146275
Right 978343644 4:107742721-107742743 ACCTGTAGTCCCAGCTACTCGGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343644 Original CRISPR ACCTGTAGTCCCAGCTACTC GGG Intergenic
Too many off-targets to display for this crispr