ID: 978343646

View in Genome Browser
Species Human (GRCh38)
Location 4:107742724-107742746
Sequence TGTAGTCCCAGCTACTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 801512
Summary {0: 54131, 1: 174214, 2: 265888, 3: 193370, 4: 113909}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978343635_978343646 27 Left 978343635 4:107742674-107742696 CCCCTCTCTACAAAATATGCAAA No data
Right 978343646 4:107742724-107742746 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
978343637_978343646 25 Left 978343637 4:107742676-107742698 CCTCTCTACAAAATATGCAAAAA No data
Right 978343646 4:107742724-107742746 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
978343636_978343646 26 Left 978343636 4:107742675-107742697 CCCTCTCTACAAAATATGCAAAA 0: 9
1: 599
2: 14616
3: 223566
4: 146275
Right 978343646 4:107742724-107742746 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
978343634_978343646 28 Left 978343634 4:107742673-107742695 CCCCCTCTCTACAAAATATGCAA No data
Right 978343646 4:107742724-107742746 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978343646 Original CRISPR TGTAGTCCCAGCTACTCGGG AGG Intergenic
Too many off-targets to display for this crispr