ID: 978347137

View in Genome Browser
Species Human (GRCh38)
Location 4:107783204-107783226
Sequence CACATTATAATTCTTGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978347137_978347139 30 Left 978347137 4:107783204-107783226 CCAAGAACAAGAATTATAATGTG No data
Right 978347139 4:107783257-107783279 ATGTGAGAAAAATGCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978347137 Original CRISPR CACATTATAATTCTTGTTCT TGG (reversed) Intergenic
No off target data available for this crispr