ID: 978347138

View in Genome Browser
Species Human (GRCh38)
Location 4:107783235-107783257
Sequence TTTTGAAATAGTTGACTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978347138_978347140 4 Left 978347138 4:107783235-107783257 CCTGAAAGTCAACTATTTCAAAA No data
Right 978347140 4:107783262-107783284 AGAAAAATGCATCTTTGGAAAGG No data
978347138_978347139 -1 Left 978347138 4:107783235-107783257 CCTGAAAGTCAACTATTTCAAAA No data
Right 978347139 4:107783257-107783279 ATGTGAGAAAAATGCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978347138 Original CRISPR TTTTGAAATAGTTGACTTTC AGG (reversed) Intergenic
No off target data available for this crispr