ID: 978347139

View in Genome Browser
Species Human (GRCh38)
Location 4:107783257-107783279
Sequence ATGTGAGAAAAATGCATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978347138_978347139 -1 Left 978347138 4:107783235-107783257 CCTGAAAGTCAACTATTTCAAAA No data
Right 978347139 4:107783257-107783279 ATGTGAGAAAAATGCATCTTTGG No data
978347137_978347139 30 Left 978347137 4:107783204-107783226 CCAAGAACAAGAATTATAATGTG No data
Right 978347139 4:107783257-107783279 ATGTGAGAAAAATGCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978347139 Original CRISPR ATGTGAGAAAAATGCATCTT TGG Intergenic
No off target data available for this crispr