ID: 978349561

View in Genome Browser
Species Human (GRCh38)
Location 4:107807564-107807586
Sequence CTCAATTTAGATATCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978349561_978349567 19 Left 978349561 4:107807564-107807586 CCCACCAGGATATCTAAATTGAG No data
Right 978349567 4:107807606-107807628 GTTAGCCAGATAAAGAAGAAGGG No data
978349561_978349569 28 Left 978349561 4:107807564-107807586 CCCACCAGGATATCTAAATTGAG No data
Right 978349569 4:107807615-107807637 ATAAAGAAGAAGGGAAAGAGAGG No data
978349561_978349566 18 Left 978349561 4:107807564-107807586 CCCACCAGGATATCTAAATTGAG No data
Right 978349566 4:107807605-107807627 AGTTAGCCAGATAAAGAAGAAGG No data
978349561_978349564 -5 Left 978349561 4:107807564-107807586 CCCACCAGGATATCTAAATTGAG No data
Right 978349564 4:107807582-107807604 TTGAGTCCTGATAAATAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978349561 Original CRISPR CTCAATTTAGATATCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr