ID: 978349563

View in Genome Browser
Species Human (GRCh38)
Location 4:107807568-107807590
Sequence AGGACTCAATTTAGATATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978349563_978349564 -9 Left 978349563 4:107807568-107807590 CCAGGATATCTAAATTGAGTCCT No data
Right 978349564 4:107807582-107807604 TTGAGTCCTGATAAATAAGAAGG No data
978349563_978349569 24 Left 978349563 4:107807568-107807590 CCAGGATATCTAAATTGAGTCCT No data
Right 978349569 4:107807615-107807637 ATAAAGAAGAAGGGAAAGAGAGG No data
978349563_978349566 14 Left 978349563 4:107807568-107807590 CCAGGATATCTAAATTGAGTCCT No data
Right 978349566 4:107807605-107807627 AGTTAGCCAGATAAAGAAGAAGG No data
978349563_978349567 15 Left 978349563 4:107807568-107807590 CCAGGATATCTAAATTGAGTCCT No data
Right 978349567 4:107807606-107807628 GTTAGCCAGATAAAGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978349563 Original CRISPR AGGACTCAATTTAGATATCC TGG (reversed) Intergenic
No off target data available for this crispr