ID: 978349565

View in Genome Browser
Species Human (GRCh38)
Location 4:107807588-107807610
Sequence CTAACTCCTTCTTATTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978349565_978349570 16 Left 978349565 4:107807588-107807610 CCTGATAAATAAGAAGGAGTTAG No data
Right 978349570 4:107807627-107807649 GGAAAGAGAGGTTCCAGAAAAGG No data
978349565_978349566 -6 Left 978349565 4:107807588-107807610 CCTGATAAATAAGAAGGAGTTAG No data
Right 978349566 4:107807605-107807627 AGTTAGCCAGATAAAGAAGAAGG No data
978349565_978349567 -5 Left 978349565 4:107807588-107807610 CCTGATAAATAAGAAGGAGTTAG No data
Right 978349567 4:107807606-107807628 GTTAGCCAGATAAAGAAGAAGGG No data
978349565_978349569 4 Left 978349565 4:107807588-107807610 CCTGATAAATAAGAAGGAGTTAG No data
Right 978349569 4:107807615-107807637 ATAAAGAAGAAGGGAAAGAGAGG No data
978349565_978349571 19 Left 978349565 4:107807588-107807610 CCTGATAAATAAGAAGGAGTTAG No data
Right 978349571 4:107807630-107807652 AAGAGAGGTTCCAGAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978349565 Original CRISPR CTAACTCCTTCTTATTTATC AGG (reversed) Intergenic
No off target data available for this crispr