ID: 978349566

View in Genome Browser
Species Human (GRCh38)
Location 4:107807605-107807627
Sequence AGTTAGCCAGATAAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978349565_978349566 -6 Left 978349565 4:107807588-107807610 CCTGATAAATAAGAAGGAGTTAG No data
Right 978349566 4:107807605-107807627 AGTTAGCCAGATAAAGAAGAAGG No data
978349562_978349566 17 Left 978349562 4:107807565-107807587 CCACCAGGATATCTAAATTGAGT No data
Right 978349566 4:107807605-107807627 AGTTAGCCAGATAAAGAAGAAGG No data
978349563_978349566 14 Left 978349563 4:107807568-107807590 CCAGGATATCTAAATTGAGTCCT No data
Right 978349566 4:107807605-107807627 AGTTAGCCAGATAAAGAAGAAGG No data
978349561_978349566 18 Left 978349561 4:107807564-107807586 CCCACCAGGATATCTAAATTGAG No data
Right 978349566 4:107807605-107807627 AGTTAGCCAGATAAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978349566 Original CRISPR AGTTAGCCAGATAAAGAAGA AGG Intergenic
No off target data available for this crispr