ID: 978349567

View in Genome Browser
Species Human (GRCh38)
Location 4:107807606-107807628
Sequence GTTAGCCAGATAAAGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978349563_978349567 15 Left 978349563 4:107807568-107807590 CCAGGATATCTAAATTGAGTCCT No data
Right 978349567 4:107807606-107807628 GTTAGCCAGATAAAGAAGAAGGG No data
978349562_978349567 18 Left 978349562 4:107807565-107807587 CCACCAGGATATCTAAATTGAGT No data
Right 978349567 4:107807606-107807628 GTTAGCCAGATAAAGAAGAAGGG No data
978349561_978349567 19 Left 978349561 4:107807564-107807586 CCCACCAGGATATCTAAATTGAG No data
Right 978349567 4:107807606-107807628 GTTAGCCAGATAAAGAAGAAGGG No data
978349565_978349567 -5 Left 978349565 4:107807588-107807610 CCTGATAAATAAGAAGGAGTTAG No data
Right 978349567 4:107807606-107807628 GTTAGCCAGATAAAGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978349567 Original CRISPR GTTAGCCAGATAAAGAAGAA GGG Intergenic
No off target data available for this crispr