ID: 978349569

View in Genome Browser
Species Human (GRCh38)
Location 4:107807615-107807637
Sequence ATAAAGAAGAAGGGAAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978349565_978349569 4 Left 978349565 4:107807588-107807610 CCTGATAAATAAGAAGGAGTTAG No data
Right 978349569 4:107807615-107807637 ATAAAGAAGAAGGGAAAGAGAGG No data
978349561_978349569 28 Left 978349561 4:107807564-107807586 CCCACCAGGATATCTAAATTGAG No data
Right 978349569 4:107807615-107807637 ATAAAGAAGAAGGGAAAGAGAGG No data
978349562_978349569 27 Left 978349562 4:107807565-107807587 CCACCAGGATATCTAAATTGAGT No data
Right 978349569 4:107807615-107807637 ATAAAGAAGAAGGGAAAGAGAGG No data
978349563_978349569 24 Left 978349563 4:107807568-107807590 CCAGGATATCTAAATTGAGTCCT No data
Right 978349569 4:107807615-107807637 ATAAAGAAGAAGGGAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978349569 Original CRISPR ATAAAGAAGAAGGGAAAGAG AGG Intergenic
No off target data available for this crispr