ID: 978351481

View in Genome Browser
Species Human (GRCh38)
Location 4:107824887-107824909
Sequence CTCTCCCCGCCCGCCGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978351481_978351491 27 Left 978351481 4:107824887-107824909 CCGCGCGCGGCGGGCGGGGAGAG 0: 1
1: 0
2: 2
3: 22
4: 227
Right 978351491 4:107824937-107824959 GCGCCGCGCCGTGGGCCGAGTGG 0: 1
1: 0
2: 1
3: 11
4: 129
978351481_978351490 19 Left 978351481 4:107824887-107824909 CCGCGCGCGGCGGGCGGGGAGAG 0: 1
1: 0
2: 2
3: 22
4: 227
Right 978351490 4:107824929-107824951 AACACTGAGCGCCGCGCCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 22
978351481_978351492 28 Left 978351481 4:107824887-107824909 CCGCGCGCGGCGGGCGGGGAGAG 0: 1
1: 0
2: 2
3: 22
4: 227
Right 978351492 4:107824938-107824960 CGCCGCGCCGTGGGCCGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 64
978351481_978351489 18 Left 978351481 4:107824887-107824909 CCGCGCGCGGCGGGCGGGGAGAG 0: 1
1: 0
2: 2
3: 22
4: 227
Right 978351489 4:107824928-107824950 CAACACTGAGCGCCGCGCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 40
978351481_978351487 -6 Left 978351481 4:107824887-107824909 CCGCGCGCGGCGGGCGGGGAGAG 0: 1
1: 0
2: 2
3: 22
4: 227
Right 978351487 4:107824904-107824926 GGAGAGCGGGCGCGGGGCCGCGG 0: 1
1: 2
2: 14
3: 107
4: 933
978351481_978351493 29 Left 978351481 4:107824887-107824909 CCGCGCGCGGCGGGCGGGGAGAG 0: 1
1: 0
2: 2
3: 22
4: 227
Right 978351493 4:107824939-107824961 GCCGCGCCGTGGGCCGAGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978351481 Original CRISPR CTCTCCCCGCCCGCCGCGCG CGG (reversed) Intronic