ID: 978353353

View in Genome Browser
Species Human (GRCh38)
Location 4:107844033-107844055
Sequence CCACCGTGCCTGGCAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1501
Summary {0: 1, 1: 2, 2: 33, 3: 262, 4: 1203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978353353_978353357 5 Left 978353353 4:107844033-107844055 CCTCTTTTTGCCAGGCACGGTGG 0: 1
1: 2
2: 33
3: 262
4: 1203
Right 978353357 4:107844061-107844083 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
978353353_978353363 30 Left 978353353 4:107844033-107844055 CCTCTTTTTGCCAGGCACGGTGG 0: 1
1: 2
2: 33
3: 262
4: 1203
Right 978353363 4:107844086-107844108 GCCAAGACAGGCAGATCATGAGG 0: 26
1: 874
2: 4867
3: 16301
4: 36558
978353353_978353356 4 Left 978353353 4:107844033-107844055 CCTCTTTTTGCCAGGCACGGTGG 0: 1
1: 2
2: 33
3: 262
4: 1203
Right 978353356 4:107844060-107844082 CGCCTATAATCCCAGCACTTTGG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
978353353_978353362 18 Left 978353353 4:107844033-107844055 CCTCTTTTTGCCAGGCACGGTGG 0: 1
1: 2
2: 33
3: 262
4: 1203
Right 978353362 4:107844074-107844096 GCACTTTGGGAGGCCAAGACAGG 0: 3193
1: 67348
2: 183905
3: 230078
4: 178472
978353353_978353359 8 Left 978353353 4:107844033-107844055 CCTCTTTTTGCCAGGCACGGTGG 0: 1
1: 2
2: 33
3: 262
4: 1203
Right 978353359 4:107844064-107844086 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978353353 Original CRISPR CCACCGTGCCTGGCAAAAAG AGG (reversed) Intronic
900773409 1:4563588-4563610 CCACTGAGCCTGGCTAAAATGGG + Intergenic
900807897 1:4779855-4779877 CCACCGTGCCTGGCCTAAAACGG - Intronic
900961664 1:5925900-5925922 CCACCGTGCCTGGCCAGGAATGG + Intronic
900994332 1:6112335-6112357 CCCCCGTGCTTGGCAGAGAGAGG - Intronic
901102954 1:6733519-6733541 CCACCGTGCCTGGCTAATTTTGG - Intergenic
901294040 1:8146928-8146950 CCCTCGTGCCTGGCCATAAGTGG - Intergenic
901407587 1:9059819-9059841 CCACTGTGCCCGGCCTAAAGAGG + Intronic
901498248 1:9635120-9635142 CCACCACGCCTGGCTAAGAGAGG - Intergenic
901551606 1:9999257-9999279 CCACCGAGCCTGGCAAGAGTGGG - Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
901694791 1:10998912-10998934 CCACCGTGCCTGGCACACTGGGG - Intergenic
901843789 1:11969817-11969839 CCACTGCGCCTGGCTAAAGGAGG - Intronic
901856713 1:12049117-12049139 CCACCGCGCCTGGCCAAGACAGG + Intergenic
901866171 1:12108363-12108385 CCACCGTGCCTGGCGACATACGG + Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902403108 1:16168588-16168610 CCACCGTGCCTGGCAATGCCCGG + Intergenic
902597564 1:17519961-17519983 CCACCTTCTCTGGCTAAAAGGGG + Intergenic
902705769 1:18203181-18203203 CCACCTAGCCTTGCAACAAGTGG - Intronic
902815079 1:18911824-18911846 CCACTGCGCCTGGCCCAAAGGGG + Intronic
902881486 1:19374638-19374660 CCACCCTGCCAGGAGAAAAGGGG - Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
902900860 1:19514984-19515006 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
902915494 1:19636610-19636632 CCACTGCGCCTGGCCAAGAGTGG - Intronic
902985449 1:20151786-20151808 CCACCGCGCCTGGCCCAGAGCGG + Intergenic
903062714 1:20681477-20681499 CCACCGCGCCCAGCCAAAAGAGG + Intronic
903563085 1:24243686-24243708 CCACCGCGCCTGGCCAAACTGGG - Intergenic
903640502 1:24856723-24856745 CCACCGTGCCCGGCCCAAACTGG + Intergenic
903905930 1:26686500-26686522 CCACTGTACCTGACAAAATGAGG + Intergenic
903925073 1:26826420-26826442 GCACCGTGCCTGGTACACAGTGG + Intergenic
903944679 1:26954509-26954531 CCACTGCGCCTGGCCAAATGTGG + Intronic
904112249 1:28135255-28135277 CCACCGTGCCTGGCCAGAAAAGG - Intergenic
904208159 1:28868439-28868461 CCAAAGTGCCTGGCACATAGTGG + Intergenic
904223219 1:28990703-28990725 CCACTGTGCCTGGCCTCAAGGGG + Intronic
904544634 1:31259394-31259416 CCACCGCGTCTGGCAAAACCAGG + Intergenic
904564396 1:31419538-31419560 CCACCATGCCTGGCCATTAGGGG - Intronic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
904672373 1:32175495-32175517 CCACCGCGCCTGGCCAGATGTGG - Exonic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905041532 1:34964009-34964031 CCACCACGCCTGGCCAAGAGTGG - Intergenic
905140325 1:35838472-35838494 CCACCATGCCTGGTCAACAGTGG + Intronic
905376174 1:37522272-37522294 CCACTGTGCCTGGCCAAGAGCGG - Intergenic
905541356 1:38763014-38763036 ACACAGGGCCTGGCATAAAGTGG + Intergenic
905594512 1:39194628-39194650 CCACCATGCCCAGCCAAAAGTGG + Intronic
905736110 1:40327285-40327307 CCACCGTGCCTGGCCGAGATCGG + Intergenic
905960978 1:42041870-42041892 CCACTGCGCCTGGCCTAAAGAGG - Intergenic
906003187 1:42445093-42445115 CCACCGTGCCCGGCCAGAAAGGG + Intronic
906023077 1:42648225-42648247 CCACCATGCCTGGCCTTAAGAGG + Intronic
906092316 1:43191298-43191320 CCACCACGCCCGGCCAAAAGAGG - Intronic
906151365 1:43589567-43589589 CCACCGTGCCTGGCCAGAATCGG - Intronic
906223490 1:44102244-44102266 TCACCGTGCCCGGCCTAAAGTGG - Intergenic
906233130 1:44182768-44182790 CCACCGCGCCTGGCCCAGAGAGG + Intergenic
906260546 1:44385370-44385392 CCACTGTGCCTGGCAAGAAGAGG - Intergenic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
906975966 1:50573384-50573406 CCACTGTGCCTGGCCTGAAGCGG + Intronic
906980281 1:50621876-50621898 CCACTGTGCCTGGCCAGCAGGGG - Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
907508988 1:54944528-54944550 CCACTGTGCCTGGCCAAGATGGG - Intergenic
907799147 1:57747520-57747542 CCACCGTGCCTGGCCTACAATGG - Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908391978 1:63691552-63691574 CCACCGCGCCTGGCTAAGAGAGG - Intergenic
908822320 1:68101260-68101282 GCACCATGCCTGGCAGAGAGGGG + Intronic
909053893 1:70800148-70800170 CCACCGTGCCTGGCCAACATTGG + Intergenic
909613417 1:77577904-77577926 CCACCGTGCCCGGCCGAAACTGG + Intronic
909815120 1:79983254-79983276 CCACTGTGCCTGGCCACAAAAGG - Intergenic
910178106 1:84452908-84452930 CCACCGTGCCTGGCCGAATGTGG - Intergenic
910225461 1:84931736-84931758 CCACTGTGCCTGGCCCAGAGGGG - Intronic
910408755 1:86917229-86917251 CCACCGTGTCTGGTCAAAAATGG - Intronic
910506005 1:87950916-87950938 CCACCGTGCTTGGCCAAACATGG - Intergenic
910671976 1:89782864-89782886 GGACTGTGCCTGGCAAAGAGTGG - Intronic
910983168 1:92978507-92978529 CCACCGTGCCCGGCCAATAAGGG + Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911345139 1:96688032-96688054 CCACTGCGCCTGGCCTAAAGTGG - Intergenic
911628525 1:100155898-100155920 CCACCACACCTGGCCAAAAGTGG - Intronic
911952899 1:104198805-104198827 CCACCGCGCCTGGCCTACAGTGG - Intergenic
912361930 1:109102312-109102334 CCACCGCGCCTGGCTGGAAGGGG + Intergenic
912464640 1:109863290-109863312 ACACCGCGCCTGGCCACAAGTGG + Intergenic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
914357281 1:146897943-146897965 CCACAGTGCCTGGCCACAATGGG - Intergenic
914400056 1:147310663-147310685 CCACTGTGCCTGGCCAACAATGG - Intergenic
914672352 1:149880804-149880826 CCACTGTGCCTGACCAATAGTGG - Intronic
915062867 1:153200991-153201013 CCACCGCGCCTAGCAAAAGCAGG + Intergenic
915211214 1:154310998-154311020 CCACCGTGCCCGGCCAAAGATGG + Intergenic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
915459398 1:156060874-156060896 CCACCGCGCCTGGCCTCAAGTGG + Intergenic
915464721 1:156090111-156090133 GCACAGTGCCTGGCACAGAGAGG - Intronic
915467455 1:156105829-156105851 CCACCGTGCCTGGCCAGATAAGG - Intronic
915717844 1:157961379-157961401 CCACCGTGCCTGGCCAATTTTGG - Intergenic
916100797 1:161391531-161391553 CCACTGTGCCTGGCCCGAAGTGG + Intergenic
916408416 1:164520811-164520833 CCACCGTGCCTGGCCAGAGAAGG - Intergenic
916483104 1:165233165-165233187 CCGCCGTGCCCGGCCAAAACTGG - Intronic
916907808 1:169307730-169307752 CCACCGCGCCTGGCTTAAAATGG - Intronic
917035595 1:170744261-170744283 CCACCGCGCCTGGCCAAGACTGG + Intergenic
917145094 1:171882057-171882079 CCACCATGCCCGGCCACAAGAGG - Intronic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
917791140 1:178499691-178499713 CCACCACGCCCGGCATAAAGGGG - Intergenic
917845255 1:179015046-179015068 CCACCGTGCCTAGCCCCAAGTGG - Intergenic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
918297590 1:183171488-183171510 CCACCGTGCCTAGCCTTAAGGGG + Intergenic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
919353396 1:196489275-196489297 CCCCAGAGCCTGGCACAAAGTGG - Intronic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
919918154 1:202151902-202151924 ACACCGTGCCTGACAAAAATAGG + Intronic
919996961 1:202761151-202761173 CCACCGTGCCAGGCCTAAATTGG - Intronic
920370243 1:205474217-205474239 CCACCGTGCCCAGCCAAAATAGG - Intergenic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920595314 1:207263425-207263447 CCACCGTGCCTGGTTGAAAAGGG + Intergenic
920774344 1:208921592-208921614 CCACCTTGCCCAGCCAAAAGGGG - Intergenic
920914587 1:210249927-210249949 CCATCGTGCCTGGCCTAAACAGG - Intergenic
921125766 1:212176586-212176608 CCACGGTGCCTGGCCAGAAAAGG + Intergenic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922296645 1:224255477-224255499 CCACCGCGCCTGGCCTAAAATGG + Intronic
922435484 1:225601231-225601253 CCACCGTGCCTGGCCGTAATTGG - Intronic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
923150065 1:231224897-231224919 CCCACATGCCTGGCACAAAGAGG + Intronic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923568707 1:235095527-235095549 CCACCGTGCCTGGCCACACGTGG - Intergenic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
924523138 1:244822731-244822753 CCACCGCGCCTGGCCCTAAGTGG - Intergenic
924536431 1:244939736-244939758 CCACCGCACCTGGCCTAAAGCGG + Intergenic
924653748 1:245953704-245953726 CCACCGTGCCTGGCCAAGTAGGG + Intronic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
924761049 1:246986353-246986375 CCACCGTGCCTGGCACCAAAAGG + Exonic
1062785853 10:264105-264127 CCACCACGCCTGGCCACAAGTGG + Intergenic
1062870185 10:894895-894917 CCACCGTGCCTGGCTTATTGTGG - Intronic
1063091958 10:2873270-2873292 CCACCGTGCCTGGCAATCTTAGG + Intergenic
1063231688 10:4071816-4071838 CCACTGTGCCCGGCCAAAAATGG - Intergenic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063589893 10:7385710-7385732 CCACTGTGCCTGGCCAGGAGAGG - Intronic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063680010 10:8177997-8178019 CCACTGTGCCTGGCTAATAAAGG + Intergenic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064209679 10:13351630-13351652 CCAGGGAGCCTGGCAAAATGGGG - Intergenic
1064264982 10:13818836-13818858 CCACCGTGCCTGGCCATACATGG - Intronic
1064358192 10:14638901-14638923 CCACCGTGCCTGGACAAAGTAGG - Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1064612177 10:17114954-17114976 CCACCGTGCCCGGCCGAAATGGG - Intronic
1064661159 10:17609438-17609460 CCACCGTGCCCAGCTAAAAATGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1064862393 10:19841986-19842008 CCACTGTGCCTGGCCTCAAGTGG - Intronic
1065006279 10:21383209-21383231 CCACCGCGCCTGGCCAAAAGAGG + Intergenic
1065096948 10:22290692-22290714 CCACCGTGCCTGGTCAACAGTGG - Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065359683 10:24877906-24877928 CCACTGTGCCTGGCCAGAATAGG + Intronic
1065537192 10:26726772-26726794 CCACCGTGCCCGGCCTAAAATGG - Intronic
1065731508 10:28713538-28713560 CCACCGCGCCTGGCCATAATGGG - Intergenic
1065831818 10:29621440-29621462 CCACCATGCTTGGGAAACAGGGG + Intronic
1065843637 10:29726803-29726825 GCACAGGGCCTGGCAAACAGTGG + Intronic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066245286 10:33577335-33577357 TCACCGTGCCTGGCCCAAAGTGG - Intergenic
1066266636 10:33782537-33782559 CCACTGTGCCTTGCCAAGAGTGG - Intergenic
1066270626 10:33819516-33819538 CCAGGCTGCCTGGCAAGAAGGGG + Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066395315 10:35014999-35015021 CCACTGTGCCTGGCCAAAATAGG - Intronic
1066521626 10:36226394-36226416 CCACTGTGCCTGGCCAGATGAGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067055063 10:43045372-43045394 ACCCCGTGCCTGACAAAATGTGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067353660 10:45503248-45503270 CCACCGTGCCCGGCCATAATTGG - Intronic
1067410585 10:46060784-46060806 CCACAGTGCCTGGGCCAAAGTGG + Intergenic
1067411596 10:46069467-46069489 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
1067412790 10:46079454-46079476 CCACCGTGCCCGGCCTGAAGTGG - Intergenic
1067488932 10:46679690-46679712 CCACTGAACCTGGCCAAAAGTGG - Intergenic
1067499131 10:46786370-46786392 CCACCGCTTCTGGCCAAAAGAGG + Intergenic
1067595510 10:47553982-47554004 CCACCGCTTCTGGCCAAAAGAGG - Intergenic
1067605737 10:47660686-47660708 CCACTGAACCTGGCCAAAAGTGG + Intergenic
1067765059 10:49079117-49079139 CCACTGTGCCTGGCCAGAAATGG + Intronic
1067829535 10:49602465-49602487 TCCCAGTGCCTGGCAAACAGTGG - Intergenic
1068941269 10:62683541-62683563 GCACAGTGTCTGGCATAAAGTGG + Intergenic
1069023270 10:63513623-63513645 CCACCGTGCCCGGCCTAAATGGG - Intergenic
1069411167 10:68154890-68154912 CCACCGTGCCTGGCCTGAAATGG - Intronic
1069479945 10:68772603-68772625 CCACTGTGCCTGGCTTAAAATGG - Intronic
1069488418 10:68840846-68840868 CCATCGTGCCCGGCCAACAGTGG + Intronic
1069493576 10:68882782-68882804 CCACCATGCCCGGCATAAATTGG + Intronic
1069843923 10:71357536-71357558 CCACCATGCCCAGCACAAAGAGG + Intronic
1069927306 10:71859725-71859747 CCACCGTGCCTGGCCTTAAATGG - Intergenic
1069970739 10:72166313-72166335 CCACTGTGCCTGGCTAGAAAAGG - Intronic
1070121251 10:73579465-73579487 CCACTGCGCCTGGCCAAAATTGG - Intronic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1071262525 10:83933680-83933702 CCACCGTGCCTGTCCAAATGTGG - Intergenic
1071439424 10:85677301-85677323 CCAGCATGCCTGGCACACAGTGG + Intronic
1071621296 10:87122050-87122072 CCACTGAACCTGGCCAAAAGTGG + Intronic
1072049493 10:91689305-91689327 CCACCGTGCCTGGCCTACAAAGG - Intergenic
1072143185 10:92608722-92608744 CCACCGTGCCTGGCCGAACTTGG + Intronic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072213191 10:93265484-93265506 CCACCGTGCCTGGCCTATAACGG + Intergenic
1072415180 10:95241343-95241365 CCACTGTGCCTGGCAACAAGGGG + Intronic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1072542662 10:96410227-96410249 GCACCATGCCTGGCATACAGTGG + Intronic
1072897758 10:99381452-99381474 CCACCGCGCCTGGCCTAAAGAGG - Intronic
1073033503 10:100547025-100547047 TCACCGTGCCCGGCAAGAATTGG + Intronic
1073237158 10:102026944-102026966 CCACAGTACCTGGCATATAGGGG + Intronic
1073246974 10:102097930-102097952 CCACCGCGCCTGGCCCAATGTGG + Intergenic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073329148 10:102659602-102659624 CCACCGCGCCTGGCAGGAATGGG - Intergenic
1073388581 10:103151174-103151196 CCACTGTGCCTGGCCAGGAGAGG - Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074095555 10:110308837-110308859 CCACCGGGCCTGGCCAGAAATGG + Intergenic
1074144006 10:110700726-110700748 CCACCGTGCCTGGCCCAAAGAGG - Intronic
1074168614 10:110909479-110909501 CCACCGTGCCCGGCCAGAAAAGG + Intronic
1074395502 10:113094829-113094851 CCACAGTGCCCGGCCAACAGCGG - Intronic
1074544332 10:114390809-114390831 CCAGCGTCCCTGGGAAAATGGGG + Intronic
1074625383 10:115178195-115178217 CCACCGTGCCTGGCCAAGGACGG + Intronic
1074785133 10:116832451-116832473 CCACCGTGCCTGGCTGCAAAGGG + Intergenic
1075595700 10:123727600-123727622 GCACAGTGCCTGGTAAACAGTGG + Intronic
1075702570 10:124478760-124478782 CCACCGCGCCTGGCCCAAACTGG - Intronic
1075761004 10:124856562-124856584 CCACCGTGCCTGGCCAACTCTGG + Intergenic
1076660412 10:132052070-132052092 CCACCATGCCTGGCTAATTGTGG - Intergenic
1077502904 11:2917255-2917277 GCCACGTGCCTGGCACAAAGGGG - Intronic
1077608456 11:3627985-3628007 CCACCGTGCCTGGCCAAATTTGG - Intergenic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1078308049 11:10210723-10210745 CCACCGCGCCTGGCCACAAGAGG - Intronic
1078353580 11:10616016-10616038 CCACCGCGCCCAGCCAAAAGTGG - Intronic
1078362464 11:10679984-10680006 CCACTGTGCCTGGCCCAGAGTGG - Intronic
1078697244 11:13646796-13646818 CCACCTTGCCTGGCTGAAAAAGG + Intergenic
1079072339 11:17357988-17358010 CTACCATGCCTGGCCAACAGTGG + Intronic
1079324280 11:19478192-19478214 CCACCATGCCTGCCAAAAGGAGG - Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1079606460 11:22375083-22375105 CCACCGTGCCTGGCCACAAATGG - Intronic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1080799056 11:35592620-35592642 CCACCGTGCCTGGCCAGCAATGG - Intergenic
1081112678 11:39156118-39156140 CCACCGTGCCCGGCCAACACAGG + Intergenic
1081618438 11:44604235-44604257 GCACAGTGCCTGGCATGAAGTGG + Intronic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081732504 11:45381418-45381440 TCATCGTGCCTGCCAACAAGTGG - Intergenic
1081738352 11:45420928-45420950 CAACAGTGGCTGGCACAAAGAGG - Intergenic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1081890736 11:46540117-46540139 CCACCGTGCCCGGCAGTAACTGG + Intronic
1081911659 11:46704018-46704040 CCACCGTGCCCGGCTGGAAGGGG + Intronic
1082030342 11:47599050-47599072 CCACCGTGCCCGGCCTGAAGAGG + Intergenic
1082275696 11:50219084-50219106 CCACTGTGCCTGGCCCACAGAGG - Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082916422 11:58443311-58443333 CCACCGCGCCTGGCCAAACTTGG - Intergenic
1083131268 11:60624906-60624928 CCACTGTGGCTGGCCAAAATAGG - Intergenic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083254954 11:61490167-61490189 CCACCGGGCCTGGGGAACAGGGG - Intronic
1083275188 11:61593026-61593048 CCACCGTGCCTGGCCCACAATGG + Intergenic
1083444344 11:62697498-62697520 CCACTGTGCCGGGCCCAAAGCGG - Intronic
1083582490 11:63833765-63833787 CCACCATGCCTAGCTAACAGGGG + Intergenic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083643505 11:64158528-64158550 CCACCACGCCTGGCCCAAAGTGG + Intronic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1083785775 11:64945822-64945844 CCACCGTACCAGGCAAAGAGAGG + Intronic
1083822220 11:65179549-65179571 CCACCGCGCCTGTCAAAAAATGG - Intronic
1083893646 11:65609483-65609505 CCACCGTACTTGGTACAAAGAGG + Intronic
1083921813 11:65785422-65785444 CAGCTGTGCCTGGCACAAAGTGG - Intergenic
1083937211 11:65876093-65876115 CCACCGTGCCTGGCCTATTGTGG - Intergenic
1083937291 11:65876565-65876587 CCACTGTGGCTGGCACAGAGTGG - Intergenic
1083991436 11:66248330-66248352 CCACCGTGCCCGGCCAAAATAGG - Intergenic
1084152320 11:67294795-67294817 CCACCGTGCCTGGCCACTAAGGG + Intronic
1084299224 11:68235449-68235471 CCACCGTGCCTGGCCCACAGCGG - Intergenic
1084378032 11:68791822-68791844 CCACCGCGCCTGGCCAGAATGGG + Intronic
1084619028 11:70255935-70255957 GCCCGGTGCCTGGCATAAAGTGG + Intergenic
1084960461 11:72713558-72713580 CCACCGCGCCTGGCCAGAGGTGG - Intronic
1084985829 11:72870611-72870633 CCACCGCACCTGGCCCAAAGGGG - Intronic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085212394 11:74792686-74792708 CCACCATGCCTGGCAAGAGTAGG + Intronic
1085215105 11:74822881-74822903 ACACAGTGCCTGGCATACAGTGG - Intronic
1085232767 11:74987524-74987546 CCACCGCGCCTGGCAATAATGGG - Intergenic
1085460663 11:76691284-76691306 CCACCGTGCCTGGCCTACTGTGG + Intergenic
1086091524 11:83009351-83009373 CCACCGCGCCCGGCCAAAAACGG + Intronic
1086109478 11:83183775-83183797 CCACCGTGCTCGGCCAAAATAGG + Intronic
1086204617 11:84242691-84242713 CCACCGCACCTGGCCAAAATAGG + Intronic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087251340 11:95903825-95903847 CCACCATGCCTGGCCTAATGAGG - Intronic
1087768566 11:102182104-102182126 CCACCATGCCTGGCCCTAAGTGG + Intronic
1088288313 11:108209600-108209622 CCACCGTGCCTGGCCCAATGTGG - Intronic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1088632944 11:111791802-111791824 CCACTGTGTCTGGCCAAAGGAGG - Intronic
1088637921 11:111842182-111842204 CCACTGTGCCTGGCCTAAGGTGG + Intronic
1088665644 11:112090981-112091003 CCACCGTGCCCAGCCTAAAGGGG + Intronic
1088851182 11:113704814-113704836 GCACAGAGCCTGGCACAAAGTGG + Intronic
1089408937 11:118222126-118222148 CCACTGTGCCTGGCCAGCAGGGG - Intronic
1089420129 11:118325841-118325863 CCACCGTGCCTGGCCAGATATGG - Intergenic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089486232 11:118848282-118848304 CCACCGCGCCCGGCAACAACTGG + Intergenic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089843668 11:121441234-121441256 CCACAGCGCCTGGCCAATAGAGG - Intergenic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090199528 11:124844357-124844379 CCACTGTGCCTGGCCCAGAGAGG + Intergenic
1090353359 11:126122143-126122165 CCACCGTGCCTGACCCACAGAGG + Intergenic
1091181040 11:133605040-133605062 TCACTGTGCCTGGAAGAAAGAGG + Intergenic
1091463187 12:661366-661388 CCACCGTGCCCAGCCAAAGGTGG + Intronic
1091491957 12:940309-940331 CCACCGCGCCCGGCCAACAGAGG - Intronic
1092265319 12:6976435-6976457 CCACCGTGCCCGGCCCAAAGGGG - Exonic
1092338850 12:7658349-7658371 CCACCGTGCCCGGCCAAAATTGG + Intronic
1092340965 12:7675781-7675803 CCACTGTGCCCGGCCAAAATTGG - Intergenic
1092390608 12:8074245-8074267 CCACCGTGCCTAGCGAGAAAAGG + Intergenic
1092393279 12:8100696-8100718 CCATTGTGCCTGGCCCAAAGAGG + Intergenic
1093032157 12:14298185-14298207 CCACCGTGCCTGGCCAGGAATGG - Intergenic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093292802 12:17349514-17349536 TAGCAGTGCCTGGCAAAAAGTGG - Intergenic
1093454598 12:19352701-19352723 CCACAGCACCTGGCCAAAAGAGG + Intronic
1093483061 12:19625221-19625243 CCACCGTGCCTGGGCTAAAATGG - Intronic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1094090913 12:26648232-26648254 CCACTGAGGCTGGCAAAAAATGG + Intronic
1094357199 12:29590497-29590519 CCACCATGCCTGGCCACACGTGG - Intronic
1094601604 12:31913710-31913732 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1094747506 12:33362668-33362690 CCACCGTGCCCAGCAAAAAGAGG - Intergenic
1096419572 12:51445453-51445475 CCGCTGTGCCTGGCCAGAAGTGG + Intronic
1096479712 12:51930979-51931001 CCACCGTGCCTGGCCAGAAGAGG - Intergenic
1096486960 12:51989570-51989592 CCACTGTGCCTGGCCTAAATTGG + Intronic
1096523995 12:52199935-52199957 GCACGGTGCCTGGCATATAGTGG + Intergenic
1096793511 12:54059965-54059987 CCTCCAGGCCTGGCAGAAAGTGG - Intergenic
1097026774 12:56062230-56062252 CCACTGTGCCCGGCAAGGAGGGG + Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097037388 12:56132831-56132853 CCACCGTGCCTGGCCAGCATGGG - Intronic
1097202511 12:57291364-57291386 CCACTGTGCCTGGCAAAAGATGG - Intronic
1097235950 12:57539737-57539759 ACACCGTGCCTGGTGGAAAGAGG - Intronic
1098224008 12:68301964-68301986 CCACTGTGCCTGGCCAGGAGAGG + Intronic
1098360109 12:69646223-69646245 CCACCGTGCCTGGCCTTGAGAGG + Intronic
1098434396 12:70453324-70453346 CCACCGTGCCTGGCCAAATTAGG - Intergenic
1098511104 12:71314997-71315019 CCACCGTGCCTGGCCCCATGTGG + Intronic
1099345849 12:81498908-81498930 CCACCGTGCCCGGCATCATGGGG + Intronic
1099460775 12:82918194-82918216 CCACTGCGCCTGGCCAAAATTGG + Intronic
1099733683 12:86538892-86538914 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1099961079 12:89397489-89397511 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1100385902 12:94104482-94104504 CCACCGCACCTGGCCAAAACTGG - Intergenic
1100406764 12:94278708-94278730 CCACTGTGCCCGGCCCAAAGAGG - Intronic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100700342 12:97140539-97140561 CCACAGTGCCTGGTCAAAAGAGG - Intergenic
1101006172 12:100403187-100403209 CCACCACGCCTGGCAGAAAGAGG - Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101693246 12:107100738-107100760 ACACTGTGCCTGGCTAAAAAGGG + Intergenic
1101703481 12:107197679-107197701 CCACCATGCCTAGCTAAATGAGG + Intergenic
1101711766 12:107274159-107274181 CCACAGTGCCAAGCACAAAGAGG + Intergenic
1101877893 12:108607570-108607592 CCACTGTGCCTGGCTAGGAGGGG - Intergenic
1101993112 12:109503955-109503977 CCTCAGTGCCTGGCACACAGGGG - Intronic
1102091407 12:110191881-110191903 CCACCGTGCCTGGCCTGAACAGG - Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1103025526 12:117570968-117570990 CCACCGTGCCTGGCTGGAATAGG - Intronic
1103030757 12:117610450-117610472 CCACCGTGCCTGGTCATAACTGG - Intronic
1103469476 12:121168554-121168576 CCACTGTGCCTGGCCCAAGGAGG + Intronic
1103518414 12:121522142-121522164 CCACTGTGCCTGGCACAAGGTGG - Intronic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1103613850 12:122139959-122139981 CCACCGTGCCCGGCCATAAGAGG + Intronic
1103707004 12:122880828-122880850 CCCCCGAGCCTGGCACACAGAGG - Intronic
1103789431 12:123458879-123458901 CCACCGTGCCCGGCCAGGAGGGG + Intronic
1103866331 12:124054846-124054868 CCACCGCGCCTGGCCGGAAGTGG - Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1103888526 12:124221131-124221153 CCCCCGTGCCTGGCCTAAAGTGG + Intronic
1104471838 12:129035661-129035683 CCACCGTGCCTGGCCAGCACTGG + Intergenic
1104578174 12:129987766-129987788 CTACCGTGAGGGGCAAAAAGTGG - Intergenic
1105522891 13:21147203-21147225 GCACCATGTCTGGCAGAAAGGGG + Exonic
1106254830 13:28012645-28012667 CCACCACGCCTGGCTAAGAGAGG - Intronic
1106567183 13:30896453-30896475 CCACTGGGCCCTGCAAAAAGGGG - Intergenic
1106724159 13:32467563-32467585 CCATCGTGCCTGGCCAACAGAGG + Intronic
1107184635 13:37504674-37504696 CCACTGTGCCTGGCAAAGGAAGG - Intergenic
1107383074 13:39877639-39877661 CCATCGGGCATGGCAAAGAGGGG - Intergenic
1107928986 13:45290857-45290879 CCCCTGTGCCTGGCACACAGTGG - Intergenic
1107963444 13:45578763-45578785 CCACCGTGCCTGGCCAGATTTGG - Intronic
1108079497 13:46720097-46720119 CCACCGTGCCTGGCCAAGGTAGG - Intronic
1108087517 13:46809662-46809684 CCACCGTGCCTGGCCAGATCTGG - Intergenic
1108293699 13:48990035-48990057 CCACCGTGCCTGGCCCATAAAGG + Intronic
1108402177 13:50057046-50057068 CCACCATGCCTGGCGAAACATGG + Intergenic
1108638853 13:52363169-52363191 CCACCTTGTCTGGCCATAAGTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109393303 13:61721358-61721380 CCACTGTGCCCGGCCAAAATTGG + Intergenic
1110527047 13:76550436-76550458 CCACCGTGCCTGGCCAGTATAGG - Intergenic
1110773108 13:79374179-79374201 CCACTGTGCCCAGCATAAAGTGG - Intronic
1111483457 13:88863963-88863985 CCACCGCGCCTGGCCTAAATGGG - Intergenic
1111762542 13:92483838-92483860 CCACAGTGCCTGGCAAGACTAGG - Intronic
1111795874 13:92918968-92918990 CCACCGTGCCTGGCCACTAATGG + Intergenic
1111797916 13:92946701-92946723 CCACCGCGCCCGGCCAATAGTGG + Intergenic
1112006008 13:95254183-95254205 CCACTGCGCCTGGCCTAAAGGGG + Intronic
1112076769 13:95922532-95922554 CCACTGTGCCTGGCCAAAGATGG - Intronic
1112124486 13:96449247-96449269 CCACTGTGCCTGGCATAATCTGG + Intronic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1112497164 13:99914481-99914503 CCACTGTGCCCGGCCAAAACTGG - Intergenic
1112657659 13:101469392-101469414 CCACAGCGCCTGGCAACAACTGG - Intronic
1113167347 13:107456860-107456882 CCACAGTTCCTGTAAAAAAGAGG + Intronic
1114214976 14:20650464-20650486 CCACCGTGCCTGGCCACCACTGG - Intergenic
1114284975 14:21232652-21232674 CCACCGAACCTGGCCAAATGTGG + Intronic
1114321690 14:21551959-21551981 CCACCATGCCTGGCCCCAAGGGG - Intergenic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115402011 14:32972223-32972245 CCACCGCGCCTGGCCATCAGTGG + Intronic
1115674317 14:35652690-35652712 CCACCGTGCCCAGCCAAATGTGG + Intronic
1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG + Intergenic
1116171771 14:41411726-41411748 CCACCGTGCCTGGTCGAAAATGG - Intergenic
1116523120 14:45873202-45873224 CCACTGTGCCTGGCCACAAGTGG - Intergenic
1117272463 14:54158882-54158904 CCACAGTGACTGGCATAGAGAGG - Intergenic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117422586 14:55561542-55561564 CCACCGTGCCTGACCATATGTGG - Intronic
1117679124 14:58185087-58185109 CCACCGTGCCCGGCCAGATGTGG + Intronic
1117966564 14:61212693-61212715 GCACAGTGCCTGCCAAATAGTGG - Intronic
1118030868 14:61816722-61816744 CCACCGCGCCCGGCCAAGAGTGG - Intergenic
1118227304 14:63913988-63914010 CCACTGTGCCTGGCCATAAATGG + Intronic
1118352483 14:64983129-64983151 CCACCGCGCCTGGCTATGAGGGG - Intronic
1118633782 14:67729177-67729199 CCCCGGTGCCTGGGACAAAGAGG - Exonic
1118994908 14:70826930-70826952 CCACCGTGCCTGGCCCAATTTGG - Intergenic
1119036508 14:71234129-71234151 GCACAGTGCCTGGCTAGAAGCGG - Intergenic
1119283791 14:73433800-73433822 CCACCGCGCCTGGCCTAAATCGG - Intronic
1119707605 14:76794382-76794404 CCACTGCGCCTGGCCTAAAGGGG - Intronic
1120233631 14:81866212-81866234 CCACCGTGCCTGGCCAGATGTGG + Intergenic
1120668063 14:87330858-87330880 ACACAGTGTCTGGCAAAAAAGGG + Intergenic
1121033764 14:90682348-90682370 CCACCTTGCCTGCCACAAATAGG - Intronic
1121138385 14:91519259-91519281 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1121154532 14:91670714-91670736 CCACTGCGCCTGGCCAAAAGTGG - Intronic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121382556 14:93486367-93486389 CCACTGTGCCTGGCCCCAAGAGG - Intronic
1121456557 14:94042419-94042441 CCCCAGTGCCTGGCACAGAGGGG + Intronic
1121497893 14:94409593-94409615 CCACTGTGCCTGGCCAACAGAGG + Intergenic
1121644023 14:95505400-95505422 CCACCTGGCCTGGCAGAGAGTGG - Intergenic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1122977193 14:105175685-105175707 CCACCGTGCCTGGCCCAGCGTGG + Intronic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1123446503 15:20334621-20334643 CCACCGTGCCTGGCCAATGTTGG + Intergenic
1123701808 15:22919733-22919755 CCACTGTGCCTGGCCAAAGAAGG - Intronic
1123818802 15:24005668-24005690 CCACCGTGCCTGGCCAAGGATGG + Intergenic
1124336449 15:28860982-28861004 CCACCGTGCCCGGCCAACAGTGG + Intergenic
1124915156 15:33963207-33963229 GCACAGTGCCTGGCACAGAGAGG - Intronic
1124984521 15:34593089-34593111 CCACCGTGCCCGGCCAATATTGG + Intergenic
1125342297 15:38686890-38686912 CCACCATGCCTGGTAAAACATGG - Intergenic
1125706399 15:41741059-41741081 CCACCGCGCCCGGCCAAAATAGG - Intronic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1125870666 15:43099047-43099069 CCACCGTGCCTGGGCTATAGGGG - Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1125971137 15:43912728-43912750 CCACCGCGCCCGGCCCAAAGGGG - Intronic
1126072581 15:44877907-44877929 CCACCATGCCTGGCCTCAAGAGG + Intergenic
1127072190 15:55297913-55297935 CCACTGTGCCTGGCCACAACTGG - Intronic
1127424701 15:58844258-58844280 CCACCGTGCCCGGCCAACAATGG - Intronic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1127911988 15:63424154-63424176 CCACTGTGCCTGGCCTAAAGTGG + Intergenic
1127918323 15:63473525-63473547 TCAGAGTGCCTGGCACAAAGTGG - Intergenic
1128268615 15:66289757-66289779 CCACCGCGCCTGGCCCACAGTGG - Intergenic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128888182 15:71307482-71307504 CCACCGTGCCTGGCCTGAATGGG - Intronic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129444812 15:75609474-75609496 CCACCGCGCCCGGCCCAAAGTGG + Intronic
1129510033 15:76114981-76115003 CCACTGTGCCTGGCCAACAAGGG - Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129991887 15:79972505-79972527 CCACCGTGCCTGGCCCAAAGAGG - Intergenic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1130673543 15:85933178-85933200 GCACAGCGCCTGGCACAAAGTGG + Intergenic
1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG + Intergenic
1131145755 15:90010579-90010601 CCACCGCACCTGGCCAAAACAGG + Intronic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131373856 15:91907491-91907513 CCACTGTGCCTGGCCCAAGGAGG + Intronic
1131509498 15:93041872-93041894 CCACCGTGCCCGGCCAAAAAAGG - Intronic
1132118194 15:99153084-99153106 CCACCGTGCCTGGCCAGCACTGG + Intronic
1132126811 15:99234657-99234679 CCACCGCACCTGGCCAAAAATGG + Intronic
1132177400 15:99726429-99726451 CCACTGTGCCTGGCCCCAAGTGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132558217 16:582041-582063 CCACCGTGCCTGGCTGCAGGAGG + Intronic
1132573279 16:653327-653349 CCACAGGGCCTGGCACAAGGGGG - Exonic
1132596593 16:753851-753873 CCACCGTGCCCGGCTAAAGGTGG - Intronic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1132866711 16:2096802-2096824 CCACCGCGCCCGGCCAAAAATGG + Intronic
1132979806 16:2731495-2731517 CCACCGCGCCTGGCCAAAAATGG + Intergenic
1133064392 16:3195781-3195803 CCCCAGTGCCTGGCACACAGAGG + Intergenic
1133193176 16:4149689-4149711 CCACCGTGCTTGGCCCAAAGCGG - Intergenic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1133759429 16:8786433-8786455 CCACCGTGCCTGGCCATCAAAGG + Intronic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134242253 16:12514575-12514597 CCACCATGTCTGGCCAAGAGAGG - Intronic
1134406387 16:13962777-13962799 CCACTGTGCCTGGCCTAAAATGG - Intergenic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135147636 16:19976560-19976582 CCACTGTGCCTAGCCAAAATTGG + Intergenic
1135234810 16:20745296-20745318 CCACCGTGCCTGGCCCCAAGTGG - Intronic
1135295874 16:21278622-21278644 TCACCGTGCCTGGGAAAGAATGG + Intronic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135787205 16:25360797-25360819 CCACCGCGCCCGGCCAATAGGGG - Intergenic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1135956573 16:26961040-26961062 CTACCATGCCTGGCACAGAGCGG - Intergenic
1136249425 16:28994249-28994271 CCACCGTGCCTGGCCACACTGGG - Intergenic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136571261 16:31098349-31098371 CCACCATGCCTGGCCCACAGGGG + Intergenic
1136624613 16:31454393-31454415 CCACCGTGCCCGGCCAGGAGGGG + Intergenic
1137413513 16:48249902-48249924 CCACCACACCTGGCCAAAAGGGG - Intronic
1137440342 16:48493541-48493563 CCACCGTGCCTGGCCAACTTAGG - Intergenic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137640328 16:50023433-50023455 CCACTGTGCCTGGCCTAAAGAGG + Intergenic
1137695913 16:50461969-50461991 CCACCGTGCCTGGCCAAGGATGG - Intergenic
1137764652 16:50968560-50968582 CCACCGTGCCTGGCCTGAATGGG - Intergenic
1137975762 16:53030551-53030573 CCAACGTGCCTGGCCTAAAAGGG - Intergenic
1138190949 16:55013797-55013819 CCACTGTACCTGGCCAAAAAAGG - Intergenic
1138500930 16:57443736-57443758 CCACCGTGCCTGGCCAATTTTGG + Intronic
1138585808 16:57969931-57969953 CCAGGGTCCCTGGCAGAAAGGGG - Intronic
1138674317 16:58640032-58640054 CCACCGTGCCTGGCCCGTAGAGG + Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1139097235 16:63718986-63719008 CCACCGTGCCTGGCCTAGGGAGG + Intergenic
1139258538 16:65568057-65568079 CCACTGTGCCTGGCTAACAATGG - Intergenic
1139401809 16:66687972-66687994 CCACCGCGCCTGGCCAAAATGGG + Intronic
1139414762 16:66799513-66799535 CCACCGTGCCTGGCCTAAGAGGG + Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1139893397 16:70269034-70269056 CCACCGTGCCCGGCCAGAGGTGG - Intronic
1140350218 16:74255524-74255546 CCACCGCGCCCGGCAGAAAAAGG - Intergenic
1140362712 16:74358114-74358136 CCACCGTGCCTGGCCTGCAGTGG - Intergenic
1140373408 16:74425951-74425973 CCACCGTGCCTGGCCATGTGTGG - Intergenic
1140960383 16:79906433-79906455 CCACCATGCCTGGCCACATGTGG - Intergenic
1141087301 16:81105418-81105440 CCACCGCGCCCGGCAATAATAGG + Intergenic
1141468689 16:84223797-84223819 GAACCATGCCTGGCACAAAGTGG - Intronic
1141517744 16:84557631-84557653 GCCCAGTGCCTGGCAAACAGTGG - Intergenic
1141662840 16:85450771-85450793 CCACCGTGCCCGGCCAAACCTGG - Intergenic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1141738019 16:85868237-85868259 CCACCGCGCCTGGCCAAGAGGGG - Intergenic
1141878655 16:86843364-86843386 CCACCGCGCCCGGCCAAAAAAGG - Intergenic
1142360997 16:89626828-89626850 CCACCGCGCCTGGCCAAGACTGG - Intronic
1142378225 16:89717661-89717683 CCACCGTGTCTGGCAAGGTGGGG - Intronic
1142437531 16:90071414-90071436 CCACTGTGCCTGGCCCAGAGTGG + Intronic
1142704622 17:1686799-1686821 CCACCGTGCCAGGCCAAAAAAGG + Intergenic
1143025419 17:3938822-3938844 CCACCGTGCCCGGCCAAGACTGG + Intronic
1143221689 17:5267336-5267358 CCACCGTACCTGGCCGACAGAGG - Intergenic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143260890 17:5597455-5597477 CCACCGTGCCCGGCCAAGGGTGG + Intronic
1143346920 17:6256581-6256603 CCACCGTGCCCGGCCAAAGTTGG - Intergenic
1143393412 17:6573922-6573944 CCACTGTGCCTGGCGAAGAGCGG + Intergenic
1143421164 17:6793595-6793617 CCACCGTGCCTGGACAAATTTGG + Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143643376 17:8213030-8213052 CCACCGCGCCTGGCCAGAACTGG - Intergenic
1143797213 17:9346838-9346860 CCACCGTGCCCAGCAAGGAGAGG - Intronic
1143900807 17:10173479-10173501 CCACCGCGCCTGGCCGAGAGAGG - Intronic
1144087464 17:11823642-11823664 CCACCGTGCCCGGCCGACAGGGG - Intronic
1144579913 17:16452719-16452741 CCACCCTGCCTGGCCACACGGGG + Intronic
1144803030 17:17944198-17944220 TCATGGTGCCTGGCACAAAGTGG + Intronic
1145053555 17:19682749-19682771 CTACCATGCATGGCAAACAGTGG + Intronic
1145054393 17:19690829-19690851 CCACCGTGCCCGGCCAAGGGGGG - Intronic
1145075847 17:19854009-19854031 CCACTGTGCCTGGCCAGAATTGG - Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145350941 17:22082616-22082638 TCACCGTGCCTGGCAAATTATGG + Intergenic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1145868189 17:28254023-28254045 CCACCATGCCTGGCCAGGAGCGG - Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1145950172 17:28811151-28811173 CCACCGCGCCTGGCCTAAATGGG - Intronic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1146363382 17:32197713-32197735 CCACCGTGCCTGGCCACACCCGG + Intronic
1146590044 17:34121025-34121047 CCACCGTGCCTGGCCAGTACTGG + Intronic
1146898996 17:36569038-36569060 CCACCGTGCCTGGCCTACAAAGG + Intronic
1146935993 17:36813060-36813082 CAGCCGTGCCTGGGAAGAAGGGG + Intergenic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147115063 17:38293030-38293052 CCACCGTGCCCAGCCAAAAAGGG - Intergenic
1147263330 17:39221384-39221406 CCACCGCGCCTGGCCAAGACTGG + Intronic
1147398141 17:40161262-40161284 CCACTGTGCCAGGCCAAAATAGG + Intronic
1147487961 17:40836568-40836590 CCACTGTGCCTGGCTAAAATGGG + Intergenic
1147532027 17:41288379-41288401 CCACTGTGCCAGGCCAAAATGGG - Intergenic
1147538718 17:41338134-41338156 CCACAGTCCCAGGCACAAAGTGG - Intergenic
1147871910 17:43593438-43593460 CCACCCTGCCCGGCTGAAAGTGG - Intergenic
1148141327 17:45331026-45331048 CCACCGTGCCTGGCCCACCGTGG + Intergenic
1148492126 17:48029996-48030018 CCACTGTGCCTGGCCTAAAAGGG - Intronic
1148670974 17:49409821-49409843 CCACCGCACCTGGCCACAAGTGG + Intronic
1148800608 17:50222751-50222773 CCACCGTGCCTGGCAAATCTTGG - Intergenic
1148849065 17:50545746-50545768 CCACCGTGCCTGGCCAGAGAAGG - Intronic
1148878986 17:50710946-50710968 CCACCGTGCCTGGCCAGCACTGG - Intergenic
1148886197 17:50774733-50774755 CCACTGTGCCTGGCAAAGTTAGG - Intergenic
1148922897 17:51054721-51054743 CCACCGCACCTGGCCAAATGTGG + Intronic
1148928215 17:51106507-51106529 CCACCGCGCCTGGCAGAACAAGG - Intronic
1148987681 17:51637852-51637874 ACACTGTGCCTAGCACAAAGAGG - Intronic
1149265993 17:54928264-54928286 CCACAGTGTCTGGCATACAGAGG - Intronic
1149707256 17:58706139-58706161 CCACCGTGCCTGGCCAGCAAAGG - Intronic
1149890396 17:60384502-60384524 CCACCGTGCCTGGCCTAGGGCGG - Intronic
1149931147 17:60756897-60756919 CCACCGCGCCTGGCCAAGAAGGG - Intronic
1149981162 17:61312482-61312504 CCACTGTGGCTGGCACAAACAGG + Intronic
1150175826 17:63054666-63054688 CCACCGTGCCCGGCCATAAGTGG + Intronic
1150774622 17:68069484-68069506 CCACCGTGCCTGGCTCAACCTGG + Intergenic
1150931303 17:69588316-69588338 CCACTGTGCCCGGCCATAAGTGG + Intergenic
1151209468 17:72533575-72533597 CCACTGTGCCTGGCCCAAAATGG - Intergenic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1151640204 17:75386886-75386908 CCACCGCGCCTGGCCAAGATCGG - Intronic
1151713387 17:75819202-75819224 CCACAGGACCTGGCACAAAGCGG - Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1151907706 17:77059735-77059757 CCACCGTGCCTGGCCCAAGAGGG + Intergenic
1152557279 17:81059736-81059758 CCACCACGCCTGGCTGAAAGAGG + Intronic
1152582791 17:81174660-81174682 CCACCGCGCCTGGCAAACAGAGG - Intergenic
1152987309 18:332540-332562 TCACGGTGCCTGGCATATAGAGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153208387 18:2730455-2730477 CCACCGTGCCTGGCCCACAAAGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153832815 18:8938241-8938263 CCACCATGCCTGGCCACAGGTGG - Intergenic
1154174045 18:12071765-12071787 CCACCGTGCCTGGCCACAAAAGG - Intergenic
1154179364 18:12118318-12118340 CCACCGTGCCCGGCCTAAAAAGG - Intronic
1154306149 18:13232353-13232375 AAACCATGCCAGGCAAAAAGGGG - Intronic
1154318587 18:13325903-13325925 CCACCGTGCCTGCCACCACGCGG + Intronic
1155230371 18:23767858-23767880 CCACCGTGCCTGGCAAGGAAAGG + Intronic
1155436763 18:25820631-25820653 TCACAGTGCCTGGCATGAAGAGG - Intergenic
1155456144 18:26016433-26016455 CCACCGTGCCTGGCCAGAATAGG - Exonic
1155496983 18:26452345-26452367 CCACCGTGCACGGCCAACAGTGG + Intergenic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1155950156 18:31902761-31902783 CCACCGCGCCTGGCCAGTAGGGG - Intronic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156317125 18:35980479-35980501 CCACAGTGCCCAGCCAAAAGAGG + Intergenic
1156385252 18:36598834-36598856 CCACCGCGCCTGGCCAAAGAAGG + Intronic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1157207478 18:45712871-45712893 CCACCATGCCTGGCCAAAGGAGG + Intergenic
1157221968 18:45834710-45834732 CCCCAGTGCCTGGCATAAAGTGG + Intronic
1157373374 18:47139169-47139191 CCACCGTGCCCGGCCAACAAAGG - Intronic
1157835102 18:50894274-50894296 CCACCGCGCCCGGCCAAAAAGGG - Intronic
1157835154 18:50894581-50894603 CCACCGTTCCCGGCCAAAATAGG - Intronic
1157850903 18:51050068-51050090 CCACCGTGCCTGGCTGACAGTGG - Intronic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158132170 18:54164171-54164193 CCACTGTGTCTGGCAGAAAGAGG + Intronic
1158560993 18:58513587-58513609 CCACCATGCCTGGCAAATTTGGG - Intronic
1158849956 18:61485784-61485806 CCACCGCACCTGGCCAAAATGGG - Intronic
1160445919 18:78926609-78926631 CCACCGTGCCTGGCAATTTCCGG - Intergenic
1161123757 19:2544676-2544698 CCACCGTGCTGGGCCAACAGTGG + Intronic
1161138731 19:2635868-2635890 CCACCGTGCCTGGCCAACTTGGG + Intronic
1161141004 19:2647738-2647760 CCACCGTGCCTGGCCCCATGTGG - Intronic
1161192107 19:2963514-2963536 CCACCGTGCCTGGCCAGAGTGGG - Intergenic
1161225608 19:3143831-3143853 CCACTGCGCCTGGCCAAGAGAGG - Intronic
1161259611 19:3330138-3330160 CCACCGTGCCTGAAGAAATGAGG + Intergenic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161406939 19:4096060-4096082 CCACCGTGCCCGGCCAAACTGGG + Intronic
1161610665 19:5240550-5240572 CCACCGTGCCCGGCCGAAAGGGG - Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161751756 19:6102835-6102857 CCACTGTGCCTGGCCATAAGAGG - Intronic
1161899668 19:7109192-7109214 CCACTGTGCCCGGCCAAAAGTGG + Intergenic
1161942211 19:7412453-7412475 CCACCGTTCCTGGCCTAAAATGG - Intronic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162139928 19:8579669-8579691 CCACCGTGCCCAGCCAGAAGGGG - Intergenic
1162154657 19:8669230-8669252 CCACCAAGCCTGGCCAAGAGAGG + Intergenic
1162245464 19:9396332-9396354 CCACTGTGCCTGGCGATAAAGGG - Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162285127 19:9732742-9732764 CCACCGTGCCCGGCCCAATGTGG + Intergenic
1162312592 19:9915803-9915825 CCACCGCGCCTGGCGAGAAAGGG + Intronic
1162397579 19:10426050-10426072 CCACCTCGCCTGGCCAAAAGTGG - Intronic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1162733314 19:12731833-12731855 CCACCGCGCCTGGTCAAAAAGGG - Intronic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1163037846 19:14581617-14581639 CCACCGCGCCTGGCCAGAAATGG + Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163305097 19:16472669-16472691 CCACTGTACCTGGCAACAAGTGG - Intergenic
1163381179 19:16969945-16969967 CCACTGCGCCTGGCAATAATAGG - Intronic
1163411584 19:17158282-17158304 CCACCGTGCCTGGCTGGCAGGGG - Intronic
1163456131 19:17406652-17406674 CCACCATGCCTGGCTCTAAGTGG - Intronic
1163497775 19:17656562-17656584 CCACCGCACCTGGCCAAAAGCGG - Intronic
1163507677 19:17717958-17717980 CCACCGTGCCCGGCAGAGATGGG - Intergenic
1163744569 19:19037636-19037658 CCACCATGCCTGGCCTGAAGTGG + Intronic
1163851197 19:19664498-19664520 CCACCGCGCCCGGCCTAAAGTGG - Intergenic
1163908779 19:20170182-20170204 CCACCGCGCCCGGCCAAAATGGG + Intronic
1163983190 19:20921126-20921148 CCACCGTGCCTGGCCTAATATGG - Intergenic
1164103218 19:22077950-22077972 CCACCGTGCCTGGCCTAGAATGG - Intronic
1164532890 19:29061525-29061547 CCACCATGCCCGGCCAATAGAGG - Intergenic
1164795656 19:31025528-31025550 CCACCGTGCCTGGCCACAGATGG + Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1164978496 19:32593895-32593917 CCACTGTGCCTGGCAAAGCTAGG - Intergenic
1165047346 19:33115780-33115802 CCACCGCGCCTGGCTAAAGTGGG + Intronic
1165426906 19:35751037-35751059 CCACCATGCCCGGCCAACAGTGG - Intronic
1165488553 19:36110181-36110203 CCACCGCACCTGGCCCAAAGGGG - Intergenic
1165653267 19:37510071-37510093 CCACTGTGCCTGGCCAAACAAGG - Intronic
1165775974 19:38404493-38404515 CCACTGTGCCTGGGCAAAGGTGG + Intronic
1165874679 19:38997824-38997846 CCACCGTGCCTGGCCAGGGGAGG - Intronic
1166021692 19:40037065-40037087 CCACCGTGCCTGGCTAATTTTGG + Intronic
1166074142 19:40404089-40404111 CCACCGCGCCCGGCCAAAAGCGG + Intronic
1166149477 19:40861793-40861815 CCACTGTGCCTGGCCAATGGAGG - Intronic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166386638 19:42385999-42386021 CCACCGCGCCTGGCCTAAAAAGG - Intergenic
1166658329 19:44628330-44628352 CCTCAGTGCCTGGCACAGAGCGG - Intronic
1166868106 19:45853348-45853370 CCACCGTGCCCAGCCAAGAGAGG - Intronic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1166985215 19:46655745-46655767 GAACAGTGCCTGGCACAAAGTGG + Intronic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167176927 19:47871275-47871297 CCACCGTGCCTGGCCAACCCTGG + Exonic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167628024 19:50605338-50605360 CCACCGTGCCTGGCCAATTTTGG + Intergenic
1167794673 19:51701783-51701805 CCACCATCCCCGGCCAAAAGTGG - Intergenic
1167898908 19:52603589-52603611 CCATCGTGCCTGGCCAGAACTGG - Intronic
1167926296 19:52823773-52823795 CCACCGCGCCTGGCCTGAAGTGG - Intronic
1168278243 19:55288870-55288892 CCACCGTGTCTGGCCAGAAGTGG + Intronic
1168309705 19:55454342-55454364 CCACAGTGGCTGGCACAGAGTGG + Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168615749 19:57835647-57835669 CCACCGTGCCTGGCAACCCTAGG + Intronic
1168621034 19:57879802-57879824 CCACCGTGCCTGGCAACCCTAGG - Intronic
924964452 2:62393-62415 CCACCATGCCTGGCCCAGAGTGG - Intergenic
925466986 2:4114879-4114901 CCACCGCGCCCAGCCAAAAGTGG - Intergenic
925916913 2:8613557-8613579 CCACCGTGCCCGGCCCATAGGGG + Intergenic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
926035855 2:9635101-9635123 CCACTGTGCCTGGCCTAAATCGG + Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926111372 2:10186440-10186462 CCACCGTGCCCGGCCAGCAGTGG + Intronic
926187554 2:10703014-10703036 CCACCGTGCCTGGCCCGAAAAGG + Intergenic
926194637 2:10755321-10755343 CCACCGTGCCTGGCCACACCTGG + Intronic
926684323 2:15687106-15687128 CCACTGTGCCTGGCCCCAAGTGG - Intergenic
926927976 2:18007472-18007494 CCACTGCGCCTGGCCAACAGTGG - Intronic
927179637 2:20435603-20435625 CCACCGTGACTGGCCGAGAGAGG + Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927522805 2:23710659-23710681 CAACCGTGCATGGAAAAAATTGG + Intergenic
927556247 2:24034860-24034882 CCACTGTGCCTGGCCAAACATGG + Intronic
927570624 2:24156343-24156365 CCACCACGCCTGGCCAGAAGGGG - Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927986353 2:27413852-27413874 CCACCGTGCCCGGCCAGACGGGG - Intergenic
928060108 2:28103594-28103616 CCACTGCACCTGGCATAAAGTGG + Intronic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928557000 2:32437175-32437197 CCACCGCTCCAGGCCAAAAGAGG + Intronic
928593303 2:32838562-32838584 GCACAGTGCCTGGAAAACAGGGG - Intergenic
929314775 2:40464180-40464202 CCACCACACCTGGCCAAAAGAGG + Intronic
929464698 2:42133984-42134006 CCACCGCGCCTGGCCACAATAGG - Intergenic
929467931 2:42162579-42162601 CCACCGTGCCCAGCCTAAAGAGG - Intergenic
929533259 2:42765137-42765159 CCACTGTGCCTGGGACACAGAGG - Intergenic
929601313 2:43206457-43206479 ACACCTTGCCTGGCACACAGTGG - Intergenic
929687485 2:44047189-44047211 CCACCGTACCTGGCCTAAGGTGG + Intergenic
930028918 2:47046502-47046524 CCACCATGCCTGCCAAGATGGGG + Intronic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930453622 2:51577344-51577366 CCTCTGTTTCTGGCAAAAAGAGG + Intergenic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
930891228 2:56390087-56390109 CAACCTTACATGGCAAAAAGTGG - Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931474333 2:62571986-62572008 CCACCATGCCTGACAAATATGGG + Intergenic
931483330 2:62665808-62665830 CCTCAGGGCCTGGCACAAAGTGG - Intergenic
931544273 2:63363886-63363908 ACACTGTGCCTGGCAAAAATTGG - Intronic
931873337 2:66484845-66484867 CCACTGCGCCTGGCCAAAAAGGG + Intronic
932254855 2:70275809-70275831 CCACCGTGCCTGGCCCATTGGGG - Intronic
932319408 2:70810329-70810351 CCACTGTGCCTGGCCTAAAATGG - Intronic
932611303 2:73202448-73202470 CCACCTTGCCTCGCACAGAGCGG + Exonic
932704756 2:74014886-74014908 CCACAGTGCCAGGAAAAATGTGG + Intronic
933149576 2:78897655-78897677 CCACCCTGCCTGGAATAAAGAGG - Intergenic
933874037 2:86600672-86600694 CCACCGTGCCTGGCTAAGATGGG - Intronic
934066909 2:88349537-88349559 TCACCGCGCCTGGCCCAAAGCGG - Intergenic
934544410 2:95202913-95202935 CCACCGCGCCTGGCCAGAAAAGG + Intergenic
934670731 2:96210685-96210707 CCACCGTGCCTGGCCTTAAAAGG + Intergenic
934745038 2:96753695-96753717 GTACCGTGCCTGGAAGAAAGAGG + Intergenic
934852478 2:97710322-97710344 CCACCGCGCCAGGCCAAAAATGG - Intergenic
934964918 2:98712872-98712894 CCACTGTGCCTGGCCCAAAAGGG - Intronic
935235476 2:101134884-101134906 CCACCGTGCCCGGCCAAATATGG - Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
935710746 2:105896177-105896199 CCATCGTGCCTGGCTTAAACAGG - Intergenic
936102700 2:109597226-109597248 CCACCGTGCCTGGCTGGAAAAGG + Intronic
936226073 2:110653715-110653737 CCACTGTGCCTGGCCAGTAGTGG - Intronic
936473989 2:112823900-112823922 CCACCGCGCCCGGCCAAGAGTGG + Intergenic
937073514 2:119083819-119083841 CCACTGTGCCTGGCCAGATGTGG - Intergenic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
937598506 2:123699550-123699572 CCACCGTGCCTGGCCAAATGTGG - Intergenic
937821997 2:126320710-126320732 CCACCATGCCTGGCCAAGTGAGG + Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
938022144 2:127914857-127914879 CCACTCTGCCTGGCCAAAAGTGG - Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938312722 2:130303742-130303764 CCACCGTGCCTGGCCAATGAAGG - Intergenic
938571815 2:132568416-132568438 CCACCGTGCCTGGCCAACCTAGG - Intronic
938904316 2:135824254-135824276 ACACCGTGCCTGGCTCTAAGAGG - Intronic
938967298 2:136399798-136399820 CCACCGTGCCCGGCCAGAACTGG + Intergenic
939003321 2:136759716-136759738 CAACAGTGCCTGGCAAATGGCGG - Intergenic
939379884 2:141421239-141421261 CCACCGCGCCCGGCCGAAAGAGG - Intronic
939585462 2:143999046-143999068 CCAGAGTGCCTGGCAATTAGGGG - Intronic
940129275 2:150362884-150362906 CTACCGTGCCCGGCCAAAAGGGG - Intergenic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
940685003 2:156837856-156837878 GCATCTTGCATGGCAAAAAGAGG - Intergenic
941212570 2:162659628-162659650 CCACTGCGCCTGGCCAATAGTGG + Intronic
941968958 2:171329136-171329158 CCACCATGCCTGGCTACAGGAGG + Intronic
942028484 2:171935041-171935063 CCACCGCGCCTGGCCTAGAGTGG + Intronic
942097429 2:172547210-172547232 CCACCGCGCCTGGCCAAGACGGG + Intergenic
942119335 2:172761427-172761449 CCACCGTGCCCGGCCTGAAGTGG + Intronic
942154052 2:173108416-173108438 CCACCGCGCCCGGCATAAACTGG + Intronic
942724979 2:178996363-178996385 CCACCGCACCTGGCCAAAATTGG + Intronic
944099731 2:196010433-196010455 CCACCATCCCTGACAAAAAGAGG + Intronic
944238412 2:197461980-197462002 CCACCGCGCCCGGCCTAAAGAGG - Intronic
944394740 2:199253867-199253889 CCACCGTGCCTGGCCTGAAGAGG - Intergenic
944725098 2:202462998-202463020 CCACTGTGCCTGGCCAACATTGG + Intronic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
945060402 2:205903862-205903884 CCACCGTGCCTGGCCCCACGGGG + Intergenic
946667266 2:222064089-222064111 CCACAGTGTCTGGCACATAGAGG - Intergenic
946735519 2:222750780-222750802 CCACAGTGCCTTGCATACAGCGG - Intergenic
947167226 2:227274784-227274806 CCACCATGCCTGGCCGAAGGAGG + Intronic
947180668 2:227408526-227408548 CCACCGTGCCTAGCAAAAATAGG - Intergenic
947404048 2:229756101-229756123 CCCCCATGCCTGGCCAAAAGTGG + Intergenic
947434207 2:230058918-230058940 TCACCGTGCCTGGCCTAAAATGG + Intronic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
947507947 2:230724392-230724414 CCACCGTGCCCGGCCCATAGAGG - Intronic
947697160 2:232201060-232201082 CCACCGTGCCTGGCCCCAAAAGG + Intronic
947738840 2:232475556-232475578 CCACCGTGCCTGGCCGAAGGGGG - Intergenic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948032756 2:234832997-234833019 CCACCACGCCTGGCAATAAAGGG - Intergenic
948193685 2:236079230-236079252 CCACCGTGCCTGGCCAGCATGGG - Intronic
948353345 2:237358774-237358796 CTCCAGTGCCTGGCACAAAGTGG - Intronic
1168775804 20:446626-446648 CCACTGTGCCCGGACAAAAGAGG + Intronic
1168796911 20:616597-616619 CCACCGCGCCTGGCCACAAGGGG + Intergenic
1169089908 20:2853101-2853123 CCACCATGCCCGGCTGAAAGTGG - Intronic
1169105521 20:2991064-2991086 CCACTGTGCCTGGCAGGATGTGG - Intronic
1169126433 20:3130942-3130964 CCACTGCGCCTGGCCCAAAGAGG - Intronic
1169460827 20:5793414-5793436 CCACTGTGCCTGGCCTAATGTGG - Intronic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1169838229 20:9904814-9904836 CCATCATGCCTGGCCAAGAGAGG - Intergenic
1169918679 20:10709630-10709652 CCACTGTGCCTAGCCCAAAGAGG + Intergenic
1170094274 20:12628997-12629019 CCACTGTGCCTGGCATCAATAGG + Intergenic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1170333030 20:15236510-15236532 ACACAGTGCCTGGCACCAAGTGG - Intronic
1170699173 20:18687809-18687831 CCACTGTGCCTAGCCAAAATAGG + Intronic
1170774629 20:19364740-19364762 CCACCGTACCTGGCCAAGAGTGG + Intronic
1171078391 20:22152161-22152183 CCACCGCGCCTGGCAGAATAAGG + Intergenic
1171441807 20:25170187-25170209 CCACCGTGCCTGGCGATGATGGG - Intergenic
1171528803 20:25837650-25837672 CCACTGTGCCCGGCCAATAGAGG - Intronic
1171548023 20:26018236-26018258 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1171561193 20:26127572-26127594 TCACCGTGCCTGGCAAATTATGG + Intergenic
1171818393 20:29809710-29809732 CCACCGTACCTGGCAAGACTGGG + Intergenic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172264468 20:33598971-33598993 CCACCATGCCTGGCCGACAGTGG - Intronic
1172357072 20:34287677-34287699 CCACCGTGCCTGGCCAGAAGGGG + Intronic
1172629439 20:36368094-36368116 GCCCCGTGCCTGGCATACAGTGG + Intronic
1172810471 20:37644080-37644102 CCTCCGTACCTGGCCAAAAGAGG + Intergenic
1172934757 20:38611859-38611881 CCACCGTGCCTGGCCACACCCGG + Intronic
1173161637 20:40657211-40657233 GCACAGTGCCTGGCACAAGGTGG - Intergenic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173493388 20:43501416-43501438 CCATCGTGCCTGGCAAGACTGGG - Intergenic
1173520482 20:43696391-43696413 CCACCATGCCTGGCTAATTGGGG + Intronic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1173835857 20:46125052-46125074 CCACCGTGCCCGGCCACCAGTGG + Intronic
1173840923 20:46156600-46156622 CCACCGCGCCTGGCCAGCAGTGG + Intergenic
1174007411 20:47421439-47421461 CCACTGTGCCTGGCCACAAATGG + Intergenic
1174017105 20:47497822-47497844 CCACTGCGCCTGGCAAACATTGG - Intergenic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174219225 20:48939258-48939280 CCACCGCGCCTGGCCTATAGTGG + Intronic
1174251765 20:49225326-49225348 CCACTGTGCCTGGCCAGTAGTGG + Intronic
1174256285 20:49257997-49258019 CCACCGTGCCTGGCCAGAGATGG + Intronic
1174327510 20:49791055-49791077 CCACCGTGCCTGGCCCACAAAGG + Intergenic
1174569898 20:51494019-51494041 GTACAGTGCCTGGCAAAGAGTGG + Intronic
1174587560 20:51620858-51620880 CCACCGCGCCTGGCCTAGAGTGG - Intronic
1174664363 20:52243711-52243733 CCACCGTGCCTGGCAGATGTTGG + Intergenic
1175077478 20:56388522-56388544 CCACCATGCCCGGCCTAAAGAGG - Intronic
1175244183 20:57571671-57571693 CCACCGTGCCCGGCCAGAAATGG + Intergenic
1175442152 20:58999780-58999802 CCACCGTGCCCGGCCATAACTGG - Intronic
1175559397 20:59907957-59907979 CCACCGTGCCTGGCCAGGAATGG - Intronic
1175807622 20:61838522-61838544 CCACCGTGCCTGGCCGAGAGAGG - Intronic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1176140486 20:63542697-63542719 CCACCCTGGCTGGGACAAAGGGG + Intronic
1176156346 20:63623509-63623531 CCACCGCGCCCGGCCTAAAGTGG - Intronic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1177187350 21:17812520-17812542 CCACCGCGCCCGGCCAACAGTGG - Intronic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178011182 21:28289017-28289039 CCACCGTGCCTGGCCAGGATAGG + Intergenic
1178049480 21:28732329-28732351 TCACAGTGCCTGGCACACAGTGG - Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178628260 21:34236591-34236613 CCACCGTGCCTGGCCCAGATAGG - Intergenic
1178789156 21:35682622-35682644 CCACCGCGCCTGGCCTAAATTGG + Intronic
1178800810 21:35793590-35793612 CCACCGTGCCAGGCCACAACAGG + Intronic
1178854574 21:36239703-36239725 CCACGGTGCCTGGCGCACAGGGG + Intronic
1179061256 21:37981649-37981671 CCAGCGCGCCTGGCCAAATGTGG + Intronic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1180129993 21:45821178-45821200 CCAGCCTGCCAGGCAAAAAGTGG - Intronic
1180163478 21:46008301-46008323 CCACCGTGCGTGGCCAAGACTGG + Intergenic
1180217803 21:46337147-46337169 CCACCATGCCTGGCTAATTGGGG + Intronic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180626962 22:17199905-17199927 CCACCGCGCCTGGCGAGATGGGG - Intronic
1180638528 22:17279682-17279704 CCACCGTGCCCGGCCAGAAGTGG - Intergenic
1180691159 22:17717178-17717200 CCACTGTGCCTGGCCAAAGTTGG - Intronic
1181557466 22:23679628-23679650 CCACCGTGCCTGGCCACAAATGG - Intergenic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1181842718 22:25678165-25678187 CCACCGTGCCCGGCCAGCAGTGG - Intronic
1182007962 22:26977232-26977254 TCACAGTGCCTGGCACAGAGTGG + Intergenic
1182152899 22:28042956-28042978 CCACCGTGCCTGGCCCAGGGAGG - Intronic
1182346662 22:29671241-29671263 CCGCCGCGCCTGGCAGAAGGAGG - Intronic
1182781035 22:32867866-32867888 CCACCGTGTCTGGCGAGGAGTGG + Intronic
1183059909 22:35329990-35330012 CCACCGCGCCTGGCCAAGTGAGG - Intronic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183325427 22:37188754-37188776 CCCATGTGCCTGGCACAAAGGGG - Intronic
1183465679 22:37979383-37979405 CCACCGTGCCCGGCCCCAAGAGG + Intronic
1183494394 22:38134272-38134294 CCACCGTGCCTGGCCTAAAGGGG - Intronic
1183559449 22:38559454-38559476 CCACCGTGCCCTGCCAAAACAGG + Intronic
1183621056 22:38972978-38973000 CCACCGTGGCTGGCCAAAGGTGG - Intronic
1183637629 22:39074359-39074381 CCACTGCGCCTGGCACAAATGGG - Intronic
1184272845 22:43394587-43394609 CCACCGGGCCTGGCCAAATCAGG + Intergenic
1184280890 22:43436770-43436792 ACCCCGTGCCTGGCACACAGCGG - Intronic
1184407494 22:44308382-44308404 CCACAGTGCCAGGCCACAAGGGG - Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
1184840584 22:47050290-47050312 CCACCGCGCCTGGCCGAGAGGGG + Intronic
1184847245 22:47096532-47096554 CCACCGTGCCCGGCCAACAAAGG - Intronic
1184849201 22:47110190-47110212 CCACCGTGCCTGGCCAGAAAAGG - Intronic
1184963402 22:47948376-47948398 CCACTGCACCTGGGAAAAAGAGG + Intergenic
1185040738 22:48502810-48502832 CCACCGCACCTGGCCAAGAGTGG + Intronic
1185291379 22:50029452-50029474 CCACCGCGCCCGGCAATAGGGGG - Intronic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
949447684 3:4152578-4152600 CCACCGTGCCTGGCCCAGTGTGG + Intronic
949516628 3:4813447-4813469 CCACAGTCCCTGGCAAATGGCGG - Intronic
949547418 3:5083878-5083900 CCACTGTGCCTGGCCCAAATGGG - Intergenic
949584117 3:5421264-5421286 CCACCGTGCCCGGCCAAGAAAGG - Intergenic
949779329 3:7668355-7668377 CCACTGTGGGTGGCAAATAGAGG - Intronic
949973733 3:9434955-9434977 CCACTGCGCCTGGCCAAGAGGGG - Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950022854 3:9800710-9800732 CCACCATGCCTGGCCAGTAGAGG + Intronic
950056956 3:10032591-10032613 CCACCTTGCCTGGCCAGAAATGG + Intronic
950066839 3:10118773-10118795 CCACTGTGCCTGGCCATAAGTGG + Intronic
950443246 3:13022092-13022114 CCACCGAGCCAGGCATGAAGGGG - Intronic
950805358 3:15598306-15598328 CCACCGCGCCTGGCCATAACTGG + Intronic
950829138 3:15857570-15857592 CCACCGCGCCTGGCCGCAAGTGG + Intronic
950975613 3:17239721-17239743 TAACTGTGCCTGGCAAATAGAGG + Intronic
951215373 3:20019574-20019596 CCACCGCGCCTGGCCTAAATTGG - Intergenic
951501584 3:23393580-23393602 CCACCGTGCCTCTAAAACAGTGG - Intronic
951593540 3:24292640-24292662 GCACTGTGCCTGGCAAATAGTGG + Intronic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
951902433 3:27670080-27670102 CCACTGTGCCCGGCCGAAAGTGG - Intergenic
952589061 3:34929524-34929546 CCACCTTGATTGACAAAAAGAGG + Intergenic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
953481496 3:43256120-43256142 TCACAGTGCCTGGCACAGAGGGG - Intergenic
953558130 3:43963094-43963116 CCACCGTGCCTGGCTGCAGGAGG - Intergenic
953650078 3:44794672-44794694 CCACCGCGCCCGGCTAACAGGGG - Intronic
953675489 3:44998321-44998343 CCACCGTGCCTGGCCTTACGGGG + Intronic
953697169 3:45169145-45169167 CCACCGTGCCCGGCTATAACAGG + Intergenic
954211261 3:49098759-49098781 CCCCCGTGTCTGGCAAAGATTGG + Intronic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954264657 3:49462879-49462901 CCACCGTGCCTAGCCAGCAGGGG + Intergenic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954579272 3:51694416-51694438 CCACCGCGCCTGGCCAAAGAGGG + Intronic
954775017 3:53009157-53009179 CCACCGTGCCCAGCCAAAAGTGG - Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955171315 3:56567975-56567997 CCACCACGCCCGGCCAAAAGTGG + Intronic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955676377 3:61453195-61453217 GCACTGTCCCTGGCACAAAGTGG + Intergenic
956117182 3:65930442-65930464 CCACCGTGCCTGGCCACAAGTGG - Intronic
956132318 3:66065983-66066005 CCACCGAGCCTGGCCATAAGGGG + Intergenic
956516934 3:70060186-70060208 GCACAGTGCCTGGCATGAAGTGG - Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
957919434 3:86729992-86730014 CCACCGTGCCCGGCTGAAAGTGG - Intergenic
958104400 3:89053830-89053852 CCACCATGCCTGGAAAAGTGGGG + Intergenic
958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG + Intergenic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959085164 3:101844978-101845000 CCACCGTGCCCGGCCAGAATTGG - Intronic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960031526 3:113059261-113059283 CCACCACGTCTGGCCAAAAGAGG - Intergenic
960103918 3:113773223-113773245 CCACCGTGCCTGGCCAATATTGG + Intronic
960110666 3:113841577-113841599 CCACCGTGCCTGGCTGAAGTAGG + Intronic
960559617 3:119069213-119069235 CCACTGTGCCTGGCCAACAATGG + Intronic
960666341 3:120112559-120112581 CCACCGCGCCTGGCAACATTAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
961031614 3:123609794-123609816 CCACCGCGCCTGGCCAGAACTGG + Intergenic
961190670 3:124958548-124958570 CCACTGATCCTGGCAAAAAAAGG - Intergenic
961560671 3:127726715-127726737 CCACCGCGCCTGGCCTACAGGGG + Intronic
961736741 3:129006601-129006623 CCACTGTGCCCGGCCAAAAGTGG + Intronic
961967542 3:130921367-130921389 CCACTGTGCCTGGCCCAAAAGGG + Intronic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962167026 3:133060090-133060112 ACACAGTGCCTGGCACAAAAGGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962650273 3:137481478-137481500 TCACAGTGCCTGGCATACAGTGG + Intergenic
962986856 3:140544131-140544153 GCACTGTGCCTGGCACATAGCGG - Intronic
963090203 3:141476944-141476966 CCACCGTGCCTGGCCAATCTTGG + Intergenic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963829860 3:149994629-149994651 CCACCGTGCCCAGCCAAAAAAGG + Intronic
964589541 3:158344929-158344951 CCACCGTGCCTGGCCTAGATTGG - Intronic
965010189 3:163077766-163077788 CCACCGTGCCCGGCCAAAATGGG + Intergenic
965069009 3:163892519-163892541 CCACTGTGCCTGGCCATAAATGG + Intergenic
965339136 3:167464299-167464321 CCACCATGCCTGGCCAGGAGTGG + Intronic
965399046 3:168196143-168196165 CCACCGTGCCTGACCATATGAGG - Intergenic
965600002 3:170445217-170445239 CCACCGTGCCTGGCCTGAACTGG - Intronic
965768362 3:172154880-172154902 CCACCCTGCGTGGGAACAAGTGG + Intronic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966373815 3:179275439-179275461 CCACCGTGCCCGGCCAATACTGG - Intergenic
966812989 3:183865016-183865038 CCACTGTGCCTGGCCCCAAGAGG - Intronic
966896872 3:184451637-184451659 CCACAGTGCCTGGCCAACAGTGG + Intronic
967433533 3:189417883-189417905 CCACCGTGCCCCGCCAATAGTGG - Intergenic
967439900 3:189494391-189494413 CCACCGCGCCTGGCCAGTAGTGG + Intergenic
968013891 3:195309252-195309274 CCACCGTGCCTGGCCACAAGTGG - Intronic
968035877 3:195547503-195547525 CCACCGCGCCTGGCCAAGAAGGG - Intergenic
968179390 3:196580495-196580517 CCACCATGCCTGGCGAGACGGGG + Intronic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
968773815 4:2526707-2526729 CCACCACGCCTGGCGAAATGTGG - Intronic
969700994 4:8767780-8767802 CCACCGTGCCTGGCTGGATGTGG + Intergenic
969878703 4:10155630-10155652 CCATCATGCCTCCCAAAAAGTGG - Intergenic
969959749 4:10932658-10932680 CCACCGTGCCTGGCCAACAATGG - Intergenic
970436504 4:16040738-16040760 GCACCGGGCCTGGCACACAGTGG + Intronic
970597758 4:17615522-17615544 CCACCGCGCCCGGCAAAACTGGG - Intronic
970603651 4:17659771-17659793 CCACCGTGCCTGGCTGCAACAGG + Intronic
970733717 4:19140682-19140704 GCACCCCGCCTGGCAAAAAGAGG + Intergenic
971105087 4:23515888-23515910 CCACCGTGCCTGGCGTAAAATGG - Intergenic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
971397637 4:26243805-26243827 CCACTGTGCCTGGCCAAGGGAGG - Intronic
971405481 4:26318709-26318731 CCACCGCGCCTGGCAGCAATTGG - Intronic
971455044 4:26836306-26836328 GCACAGTGCCTGGCACAGAGGGG + Intergenic
971885802 4:32446027-32446049 CCACCGTGCCCGGCCTACAGTGG + Intergenic
972044784 4:34652137-34652159 CCACCGTGCCTGGCCAAATTTGG + Intergenic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972414500 4:38825082-38825104 CCAACGTGCCTGGCCGAAACTGG + Exonic
972431446 4:38986519-38986541 CCACCGTGCCTGGCCATGAATGG - Intronic
972487430 4:39555518-39555540 CCACAGTGCCTGGCCAACAGAGG + Intronic
972555841 4:40180049-40180071 CCACCGCGCCTGGCCTAGAGTGG + Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
973141904 4:46780227-46780249 CCACCGTGCCCGGCCAGCAGGGG - Intronic
973323897 4:48837576-48837598 CCACTGTGCCTGGCCAGAATGGG + Intronic
973812111 4:54581571-54581593 CCACCGTGCCTGGCCATGAAAGG - Intergenic
973946448 4:55961475-55961497 CCACCGTGCCCGGCCAAAGATGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974453810 4:62100399-62100421 CCACTGTGCCTGGCCTAGAGTGG + Intergenic
974767200 4:66362165-66362187 CCACCGTGCCTGGCTGTAAATGG + Intergenic
974901769 4:68008352-68008374 CCACTGTGCCCGGCCAAAAGAGG - Intergenic
975127321 4:70797555-70797577 CCACCGTGCCTGGCCTAGAGTGG - Intronic
976249355 4:83034630-83034652 CCACCGCGCCCGGCCGAAAGGGG + Intronic
976499376 4:85769872-85769894 CCACCGCGCCTGGCCAGTAGTGG + Intronic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
977412809 4:96689768-96689790 CCACCACGCCTGGCCAAATGTGG - Intergenic
977866561 4:102035359-102035381 CCACCGTGCCTGGCCAACATGGG - Intronic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978032495 4:103952465-103952487 CTACTGTGCCTGTCAGAAAGTGG - Intergenic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978714595 4:111826076-111826098 CCACCATGCCCGGCTAATAGAGG + Intergenic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
978854248 4:113375436-113375458 CCACTGTGCCTGGCCAACCGTGG - Intronic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
979566095 4:122155609-122155631 CCACCGCGCCTGGTGAAATGAGG + Intronic
979781391 4:124654726-124654748 CCACCGTGCCCAGCAAACAGTGG + Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
980955241 4:139421506-139421528 CCACCGCGCCCGGCCAGAAGTGG + Intergenic
981151512 4:141384377-141384399 CCACTGTGCCTGGCCAACTGTGG - Intergenic
981327070 4:143461965-143461987 CCACTGTGCCTGGCTAAATTTGG - Intronic
981340493 4:143616497-143616519 CCACTGCGCCCGGCCAAAAGTGG - Intronic
981697472 4:147573460-147573482 GCACAGTGCCTAGCACAAAGTGG - Intergenic
982035285 4:151340000-151340022 CCACCATGCCCAGCCAAAAGAGG - Intergenic
982051424 4:151506193-151506215 CCACTGTGCCTGGCCTAAATGGG + Intronic
982229564 4:153196095-153196117 CCACTGTGCCTGGCCAGAAAAGG + Intronic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
982920506 4:161267816-161267838 CCACCGTGCCCGGCCGAAAATGG + Intergenic
983579178 4:169290591-169290613 CCACAGTGCCTGGCCTAACGTGG + Intergenic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
984809500 4:183782354-183782376 CCACTGTGCCCGGGAAAAAGGGG - Intergenic
985241653 4:187937143-187937165 CCACCTTGCCTGGCCTAAAATGG + Intergenic
985665017 5:1177550-1177572 CCACCGCGCCCGGCCAAAACTGG - Intergenic
986044139 5:4021527-4021549 ACACCATGCCAGGCAAAACGTGG - Intergenic
987031627 5:13981362-13981384 GCACCGTGCCTGGCTTAGAGTGG + Intergenic
987863549 5:23513592-23513614 CCACCATGCCTGGCCCAGAGTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
987982072 5:25098375-25098397 CCACCGTGCCCGGCAGAACCAGG + Intergenic
988572070 5:32377465-32377487 CCACCGTGCCCGGCAAAATGTGG + Intronic
988637812 5:33006055-33006077 CCACCGCGCCTGGCCAAGAATGG - Intergenic
988663685 5:33301617-33301639 CCACCGTGCCTGGCCATATTTGG - Intergenic
988737060 5:34033247-34033269 CCAACCTGCCTGACCAAAAGGGG - Intronic
989037649 5:37192575-37192597 CCACCGTGCCTGGCCAGATGAGG - Intronic
989105487 5:37859123-37859145 CCACCATCCCTGGCCAGAAGAGG - Intergenic
989482522 5:41948420-41948442 CCACCGCGCCTGGCCACTAGTGG + Intergenic
989529144 5:42486558-42486580 CCACCGTGCCCGGCCAAACTTGG - Intronic
989641314 5:43585677-43585699 CCACCGCACCCGGCCAAAAGAGG - Intergenic
989744538 5:44812361-44812383 CCACCATGCATGGCACAAATAGG - Intronic
990319131 5:54612548-54612570 CCACCGTGCCTGGCTGAGGGTGG + Intergenic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
991060759 5:62372947-62372969 CCACCACGCCCGGCCAAAAGAGG - Intronic
991222090 5:64228225-64228247 CCACCGTGCCTGACCAAATTTGG - Intronic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
991716476 5:69455338-69455360 CCACCGTGCCTGGCCTCAAATGG + Intergenic
992085238 5:73272240-73272262 CCACCGTGCCTGGCCACCACAGG + Intergenic
992156128 5:73956960-73956982 CCACCGTACCTGGCCAATGGTGG + Intergenic
992294526 5:75314442-75314464 CCACTGTGCCTGGCCAAATAAGG - Intergenic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992403311 5:76431535-76431557 CCACCGTGCCCGGCCAAGACTGG - Intronic
992471204 5:77056513-77056535 CCACTGTGCCCGGCCAAGAGTGG + Intronic
992882827 5:81127634-81127656 CCACTGTGCCTGGCCAAATAAGG - Intronic
992938472 5:81737493-81737515 CCACCGCGCCTGGCCAAACAGGG - Intronic
993388192 5:87285352-87285374 CCACCGCGCCTGGCAATGAATGG + Intronic
993436668 5:87904206-87904228 GCACAGTGCCTGGAACAAAGTGG - Intergenic
993584538 5:89707962-89707984 CCAACTTGCCTGGCAGATAGTGG + Intergenic
994145144 5:96386675-96386697 CCACCATGCCTGGCAAAGTATGG - Intergenic
994839599 5:104905736-104905758 CCACCGTGCCTGGCCAGGAAAGG + Intergenic
995166181 5:109044466-109044488 CCACCACGCCTGGCCAAATGAGG + Intronic
995192897 5:109338350-109338372 CCACCGTGCCTGGCCTGAAATGG - Intronic
995680816 5:114717659-114717681 CCACCGCGCCCGGCCAGAAGAGG - Intergenic
996317830 5:122180831-122180853 TCACAGTGCTTGTCAAAAAGAGG + Intergenic
996554554 5:124764309-124764331 CCACCGCGCCTGGCCAATATGGG + Intergenic
996721150 5:126631367-126631389 CCACTGTGCCAGGCCAGAAGGGG + Intergenic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG + Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997261071 5:132465871-132465893 CCACCGTGCCGGGCTGACAGTGG + Intronic
997313807 5:132915049-132915071 CCACCGTGCCTGGCCAGAAATGG - Intronic
997574251 5:134961569-134961591 CCACCGCGCTTGGCCAGAAGTGG + Intronic
997608800 5:135195893-135195915 CCACCGTGCCTGGCTAATTTTGG + Intronic
997888196 5:137650467-137650489 CCCCAGTGCCTGGCAATTAGTGG + Intronic
997894184 5:137701333-137701355 CCACCGTGCCCGGCCAAAATTGG + Intronic
998110002 5:139493983-139494005 CCACCGTGCCTGGCCTCAAAAGG - Intergenic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998944170 5:147319427-147319449 CCACTGTGCCTGGCCACAATGGG + Intronic
999015863 5:148104606-148104628 CCACCGTGCCTGGCCAGAAATGG - Intronic
999386801 5:151159257-151159279 CCACCGTGCCTGGCCTCATGTGG + Intergenic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
999983156 5:156977127-156977149 CCACCGTGCCTGGCCAACAATGG - Intergenic
1000011331 5:157236084-157236106 CCACCGTGCCTGGCCTTAAAAGG - Intronic
1000037864 5:157462363-157462385 CCACCGTGCCTGGCCCTAAGAGG - Intronic
1000079813 5:157834052-157834074 CCTCCGTGCCTGGCCAGAACTGG - Intronic
1000092342 5:157940680-157940702 CCACCGTGCCTGGCCCCAAGTGG - Intergenic
1000251305 5:159498067-159498089 GCTCCTTGCCTGGCACAAAGAGG - Intergenic
1000331949 5:160212754-160212776 CCACCGTGCCCGGCCACAACTGG + Intronic
1000332188 5:160214591-160214613 CCACCATGCCTGGCCTCAAGTGG + Intronic
1001143332 5:169163299-169163321 CCACCGTGCGAGGAAAAAAAAGG + Intronic
1001636946 5:173217109-173217131 CCACCGTGCCTGGCCAACCATGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002208209 5:177578958-177578980 CCACCGTGCCCGGCCAATAGAGG - Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1002803932 6:553202-553224 CAACCGTGCCTGGCCAGAAAGGG + Intronic
1002922427 6:1581947-1581969 CCACCGTGCCTGGCCAACGTGGG - Intergenic
1003244246 6:4370765-4370787 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003546272 6:7061609-7061631 CCACCGTGCCCGGCCTAAAATGG + Intergenic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004363668 6:14993729-14993751 CCACCGTGCCTGGCCGAAGAGGG + Intergenic
1004371173 6:15053740-15053762 CCGCCGTGCCTGGCCAAGAATGG - Intergenic
1004384202 6:15158406-15158428 CCACGGTGCCTGGCCCAAAATGG + Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004485839 6:16065645-16065667 CCACCGCGCCTGGCTGAAATTGG + Intergenic
1004615477 6:17283702-17283724 CCACCGCGCCTGGCCCAAAATGG + Intronic
1004621996 6:17338997-17339019 CCACCGTGCCTGGCCCATATTGG - Intergenic
1004623277 6:17350125-17350147 CCACCGTGCCCGGCCAGAAGAGG + Intergenic
1004701059 6:18079894-18079916 CCACCATGCCTGGCCTAAGGAGG + Intergenic
1004997922 6:21212046-21212068 CCTCCGTGCCTGGCTACATGTGG + Intronic
1005062823 6:21792945-21792967 CCACCGTGCCTGGCCTCTAGAGG + Intergenic
1005341115 6:24844762-24844784 CCACCGCGCCTGGCCCAAAATGG + Intronic
1005638045 6:27769754-27769776 CCACCGCGCCTGGCCAAAAATGG - Intergenic
1006078932 6:31552989-31553011 CCACCGCGCCAGGCCTAAAGGGG + Intronic
1006080928 6:31566023-31566045 CCACCGTGCCTGGCTAATTTTGG - Intergenic
1006216351 6:32446641-32446663 CCACCGCGCCTGGCCAAAAACGG - Intergenic
1006375350 6:33668776-33668798 CCACAGTGCCAGGCACACAGCGG - Intronic
1006394055 6:33775600-33775622 CCACTGTGCCTGACTTAAAGTGG + Intronic
1006646160 6:35515692-35515714 CCACCGTGCCTGGCCAAGGAAGG + Intergenic
1006660738 6:35641715-35641737 CCACCGTGCCCGGCCCAAAGGGG - Intronic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1007451728 6:41945224-41945246 CCACCGTGCCTGGCCCAGATGGG - Intronic
1007617944 6:43193116-43193138 CCACCCTCCCTGGCAAAGAGCGG - Exonic
1007627000 6:43252336-43252358 CCACTGTGCCCGGCCAGAAGGGG - Intronic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1008277253 6:49555891-49555913 CCACCATGCCTGGCCAAGTGTGG + Intronic
1008364794 6:50665325-50665347 CCACTGTGCCTGGCCAACAGAGG - Intergenic
1008545583 6:52580331-52580353 CCACTGTGCCTGGCAAGAAATGG + Intergenic
1009460399 6:63905615-63905637 CCACCGCGCCTGGCCAAATAAGG + Intronic
1009887539 6:69641561-69641583 CCACCGTTCCTGGCCAGAATGGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1010433128 6:75801008-75801030 CCACCGTGCCTGGCCACATGGGG + Intronic
1010458037 6:76081873-76081895 CCACCACGCCAGGCGAAAAGAGG + Intergenic
1010521268 6:76840979-76841001 CCAACGTGCTGGGAAAAAAGAGG - Intergenic
1011102208 6:83735321-83735343 CCACCGCGCCTGGCCTAAACTGG + Intergenic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011496942 6:87946160-87946182 CCACGATGCCTGGCAAAGTGAGG + Intergenic
1011498596 6:87963777-87963799 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
1011606445 6:89110826-89110848 CCACCATGCCTGGGCAACAGTGG - Intronic
1011622609 6:89257051-89257073 CTACCGTACCTGGCACAGAGTGG + Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011695190 6:89906158-89906180 CCACCGTGCCCGGCCAAAGTTGG + Intergenic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012469270 6:99552753-99552775 CCACTGTGCCTGGCCAGAAATGG - Intronic
1012577234 6:100818279-100818301 CCACCGTGCCTGGCCAGCTGTGG - Intronic
1012664364 6:101948760-101948782 CCACTGTGCCTGGCCTAAAAAGG + Intronic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013244593 6:108274554-108274576 CCACCGTGCCCAGCCACAAGTGG - Intergenic
1013283267 6:108658709-108658731 CCACCGTGCCTGGCCAACATTGG + Intronic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1013535070 6:111056520-111056542 GCCCTGTGCCTGGCAAATAGGGG + Intergenic
1013545968 6:111157567-111157589 CCACCGTGCCTGGCCAAACTTGG + Intronic
1014333122 6:120096152-120096174 CCACCGCGCCCGGCCAAAAGTGG - Intergenic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014981649 6:127952555-127952577 CCACCACGCCTGGCCTAAAGTGG - Intergenic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1015954047 6:138582182-138582204 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1016390790 6:143572838-143572860 CCACCGTGCCCAGCCAACAGTGG + Intronic
1016458605 6:144258322-144258344 CCACCGAGCCTGGCCTAAATAGG - Intergenic
1016526076 6:145002908-145002930 CCACTGTGCCTGGCCTTAAGTGG - Intergenic
1016960639 6:149669418-149669440 CCACCGTGCCTGGCTGGATGAGG + Intronic
1017026245 6:150183791-150183813 CCACCGTGCCCGGCCCAAACTGG + Intronic
1017134134 6:151133478-151133500 CCATCATGCCTGGCCAAGAGAGG - Intergenic
1017187041 6:151611994-151612016 CCACTGCGCCTGGCCAAAACTGG + Intronic
1017476240 6:154796683-154796705 CCACCGTGCCTGGCCCCTAGAGG - Intronic
1017581776 6:155872705-155872727 CCACCGTGCCTGGCTAATTTTGG + Intergenic
1017669634 6:156757664-156757686 CCACTGTGCCTGGCCAAGGGAGG - Intergenic
1017791216 6:157801439-157801461 CTACCATGCCTGGCACACAGTGG - Intronic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1018223172 6:161601867-161601889 CCACCGCGCCCGGCATATAGTGG + Intronic
1018640722 6:165901513-165901535 CCACCGTGCCTGGCCATGCGGGG - Intronic
1018835150 6:167477550-167477572 CCACTGTGCCTGGCCAAGAGTGG + Intergenic
1018904333 6:168066209-168066231 CCACCGTGCCCGGCCTAAAGTGG - Intronic
1019855366 7:3600833-3600855 CCACCGTGCCTGGCCAATGTAGG + Intronic
1020019495 7:4854404-4854426 CCACCGCGCCCGGCCCAAAGTGG - Intronic
1020095691 7:5367713-5367735 CCACCGTGCCTGGCCAACCAAGG + Intronic
1020724917 7:11800259-11800281 CCACCGCGCCTGGCTCAAATAGG - Intronic
1020827284 7:13045302-13045324 GCACCGTGCCTGGCACATATTGG - Intergenic
1020912101 7:14143632-14143654 CCACCGCGCCTGGCCAACAGTGG + Intergenic
1020954711 7:14726418-14726440 CCACCGTGCCCGGCCAGAATCGG + Intronic
1021108120 7:16662627-16662649 CCACTGTGCCAGGCTAAAAATGG - Intronic
1021551669 7:21877586-21877608 CCACCGTGCCTAGCCTCAAGAGG - Intronic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1021721741 7:23511082-23511104 CCACCGCGCCTGGCCAAATAAGG - Intronic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1022570169 7:31444868-31444890 TCACCGTGCCTGGCCAGAAATGG + Intergenic
1022629927 7:32075576-32075598 CCACCTTCCCTAGAAAAAAGAGG + Intronic
1023024357 7:36037269-36037291 TCACTGTGCCTGGGAAAAAGAGG - Intergenic
1023735401 7:43231727-43231749 CCACCGCGCCTGGCCCCAAGAGG - Intronic
1023815358 7:43945278-43945300 CCACCGTGCCCAGCCAACAGTGG + Intronic
1024012733 7:45283890-45283912 CCACCGTGCCTGGCCTACAGTGG - Intergenic
1024295403 7:47837706-47837728 CCACAGTGTCTGGCACACAGTGG + Intronic
1024334432 7:48191693-48191715 CCACCGTGCCCGGCCAAAGAGGG + Intronic
1024608478 7:51042647-51042669 CCACCATGCCAGGCCAAACGTGG + Intronic
1025077671 7:55956991-55957013 CCACTGCGACTGGCCAAAAGGGG + Intronic
1025171895 7:56766380-56766402 CCACTGTGCCCGGCCAAAACAGG + Intergenic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025699967 7:63809175-63809197 CCACTGTGCCCGGCCAAAACAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1025987955 7:66472538-66472560 CCACCGTGCCTGGCCACTAATGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026248895 7:68649282-68649304 CCACCGTGCCAGGCAACAATGGG + Intergenic
1026279074 7:68905564-68905586 CCACCGCGCCTGGCCAATATTGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026920108 7:74149208-74149230 CCACCGTGCCCAGCCAAAAGAGG + Intergenic
1026944636 7:74307776-74307798 CCACCGTGCCCGGCAACAGTAGG + Intronic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1027710565 7:81595490-81595512 CCACCGCGCCTGGCCAAATTTGG + Intergenic
1029203945 7:98857410-98857432 CCATCGTGCCTGGCAAAACGTGG - Intronic
1029231313 7:99071345-99071367 CCACCGCGCCCGGCCAAAAACGG + Intronic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029418682 7:100460300-100460322 CCACAGCGCCTGGCCAAGAGTGG - Intronic
1029571107 7:101370146-101370168 CCACCGCGCCTGGCCTGAAGAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029808620 7:103022987-103023009 CCACCGTGCCTGGCTAATGGTGG - Intronic
1029924098 7:104297568-104297590 CCACCGCGCCTGGCCAAAAAGGG - Intergenic
1030118696 7:106084693-106084715 CCAGCGTGCCTGGCCAGAATTGG - Intergenic
1030125610 7:106150129-106150151 CCACCTTACCTGGCCACAAGTGG + Intergenic
1030949092 7:115766734-115766756 CCACCGCGCCCGGCAGTAAGAGG + Intergenic
1030990056 7:116288745-116288767 CCACCGCGCCTGGCCAAATCAGG + Intronic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1032164517 7:129534813-129534835 CCACCGCGCCTGGCCAGAGGAGG - Intergenic
1032287775 7:130555537-130555559 CCACCGTGCCTGGCTGACACTGG - Intronic
1032364516 7:131286816-131286838 CCACCGTGCCTGGCCCATTGGGG - Intronic
1032434777 7:131890852-131890874 CCATGGTGCCTGGCAAGAAATGG + Intergenic
1032568766 7:132976473-132976495 CCATAGTGCCTGGCACATAGAGG + Intronic
1032626145 7:133593032-133593054 CCACCGTGCCTGGCCTAAATTGG + Intronic
1032710516 7:134456726-134456748 TCACAGTGCCTGGCAAATATAGG - Intronic
1033046037 7:137962809-137962831 ACACAGTACCTGGCACAAAGTGG + Intronic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033105920 7:138523466-138523488 CCACCTCGCCCGGCCAAAAGGGG - Intronic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033767529 7:144510490-144510512 CCACTAGGCCTTGCAAAAAGGGG - Intronic
1033787236 7:144747496-144747518 CCACCGCGCCTGGCCTAAAGTGG - Intronic
1034175699 7:149097984-149098006 CCACCGCGCCCGGCCAAAATGGG + Intergenic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034631785 7:152536650-152536672 GCAACGTGCCTGGCACATAGTGG + Intergenic
1034701446 7:153099634-153099656 CCACCTTGCCTTTCAAAATGAGG + Intergenic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1034947873 7:155275426-155275448 CCACCATACCTGGCACAAAAAGG - Intergenic
1035220676 7:157404791-157404813 CCACCGTGCCTGGCCCAGATGGG + Intronic
1035349343 7:158235047-158235069 CCACCGGGCCTGGCCCAAAATGG + Intronic
1035427057 7:158785133-158785155 CCACCGTGCCCGGCCACTAGAGG - Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036525972 8:9535200-9535222 CCACCGCGCCCGGCCAAAATGGG - Intergenic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1037215563 8:16447089-16447111 GCACAGTGACTGGCAAGAAGTGG - Intronic
1037836088 8:22215589-22215611 TCACAGTGCCTGGCAAAAGGGGG + Intergenic
1038110249 8:24488742-24488764 ACACAGTACCTGGCACAAAGTGG - Intronic
1038340448 8:26681181-26681203 CCACCGTGCCTGGCCTAGGGTGG + Intergenic
1038503639 8:28065445-28065467 CCACCGCGCCTGGCCGAAATTGG + Intronic
1038601348 8:28946238-28946260 CCACCGTGCCCGGCCCATAGGGG + Intronic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1038818843 8:30933522-30933544 CCACCGCGCCTGGCCCAAAGTGG + Intergenic
1039043695 8:33431257-33431279 CCACCGTGCCTGGCCAACTAGGG - Intronic
1039719529 8:40148100-40148122 GCACAGTGCATGGCAAAAGGAGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039814383 8:41080158-41080180 CCACCGTGCCTGGCCGCAAGAGG - Intergenic
1039856618 8:41420724-41420746 CCACCGCGCCTGGCCATATGGGG + Intergenic
1039878878 8:41610937-41610959 CCACCGTGCCTGGCCACCACTGG - Intronic
1039911637 8:41831358-41831380 CCACCATGCCCGGCAAACATGGG - Intronic
1039960136 8:42239924-42239946 CCACCGTGCCTGGCCGTAAAAGG + Intergenic
1040060053 8:43096091-43096113 CCCCAGTGCCTGGCACACAGCGG - Intronic
1040441474 8:47447499-47447521 CCACCGCGCCTGGCCAGAAACGG + Intronic
1040650016 8:49437048-49437070 GCACAGTGCCTGGCACAACGTGG + Intergenic
1041227022 8:55711001-55711023 CCACGGTGCCTGGCCAACAGTGG - Intronic
1041922562 8:63198552-63198574 CCACCGTGCCTGGCCAAGTTGGG + Intronic
1042134980 8:65624209-65624231 CCACCATGCCTAGCAAAAAAAGG - Intronic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1042410388 8:68459516-68459538 CCACCGTGCCCGGCTGAAAAGGG + Intronic
1043110610 8:76175353-76175375 CCACTGCACCTGGCCAAAAGAGG + Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1043872319 8:85447607-85447629 CCATCGTGCCTGGCCAATACTGG - Intronic
1043970540 8:86523873-86523895 CCACCGTGCCCGGCCTGAAGTGG + Intronic
1044112313 8:88290263-88290285 CCACCGTGCCTGGCCCAATAAGG - Intronic
1044667798 8:94648931-94648953 CCACCGTGCCCAGCCAAAAATGG - Intronic
1044679995 8:94767577-94767599 CCACCTTGCCTGGCTCAACGAGG + Intronic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045046269 8:98282019-98282041 TTACCTTGCCTGGCAGAAAGAGG - Intronic
1045336639 8:101209960-101209982 CCACTGTGCCAGGCCAAAAAAGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045632793 8:104146075-104146097 CCACCGAGCCTGGCCCAAAAGGG - Intronic
1045721925 8:105122578-105122600 CCACCGCGCCTGGCCATAGGTGG - Intronic
1045782284 8:105881098-105881120 CCACCGCGCCTGGCCACAAAAGG + Intergenic
1045808572 8:106194404-106194426 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1045939778 8:107726348-107726370 CCACCGTGCCCGGCAAGAGTTGG - Intergenic
1046912588 8:119645535-119645557 CCACCGTGCCCGGCTATGAGAGG - Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG + Intergenic
1048026417 8:130591332-130591354 CCATAGTGCCTGACACAAAGTGG + Intergenic
1048797237 8:138162267-138162289 CCCCCGTGCCTGGCAACCACTGG - Intronic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049186205 8:141255365-141255387 CCACCGTGCCCAGCCAAAAAGGG + Intronic
1049366070 8:142237452-142237474 CCAAAGGGCCTGGCACAAAGGGG + Intronic
1049863202 8:144914953-144914975 CCACCATGCCTGGCCACCAGGGG + Intergenic
1049980349 9:898404-898426 TCACCGTGCCTGGCCCAGAGAGG + Intronic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050273019 9:3966506-3966528 TCACCGCGCCTGGCCTAAAGAGG - Intronic
1051275524 9:15394583-15394605 CCACCGTGCCTGGCCATATTGGG - Intergenic
1051444464 9:17125726-17125748 CCACCGTGCCTGGCCTCAAAGGG + Intergenic
1051540063 9:18205764-18205786 CCACCGTGCCTGGCCGTACGTGG - Intergenic
1051754981 9:20389485-20389507 CCACCATGCCTGGTCTAAAGTGG - Intronic
1051807572 9:21012773-21012795 CCACCACGGCTGGCCAAAAGTGG - Intronic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052832215 9:33225238-33225260 CTACTGTGCCTGGCCATAAGAGG + Intronic
1052965974 9:34340962-34340984 CCACCACGCCTGGCCAGAAGCGG + Intronic
1053051947 9:34969352-34969374 CCACCGTGCCTGGCGAAAGAGGG - Intronic
1053061352 9:35034696-35034718 CCACCGTGCCTGGCAACACCTGG - Intergenic
1053322709 9:37114412-37114434 CCACTGTGCCAGGCCAAAAGTGG + Intergenic
1053508002 9:38661310-38661332 CCACCGCACCTGGCCAATAGTGG + Intergenic
1053622429 9:39833314-39833336 CCACCGCGCCTGGCCAAGTGAGG + Intergenic
1053796786 9:41733885-41733907 CCACTGTGCCCGGCCAATAGAGG - Intergenic
1053882432 9:42609768-42609790 CCACCGTGCCTGGCCAAGTGAGG - Intergenic
1053890237 9:42684534-42684556 CCACCGTGCCTGGCCAAGTGAGG + Intergenic
1054185199 9:61945960-61945982 CCACTGTGCCCGGCCAATAGAGG - Intergenic
1054221457 9:62417236-62417258 CCACCGTGCCTGGCCAAGTGAGG - Intergenic
1054229257 9:62491937-62491959 CCACCGTGCCTGGCCAAGTGAGG + Intergenic
1054468150 9:65512078-65512100 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1054653310 9:67642536-67642558 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1054781780 9:69172858-69172880 CCACCGTGCCTGGCCAGATTTGG + Intronic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1054928236 9:70609858-70609880 CCACCGTGGCTGGAAAGAATTGG + Intronic
1055406359 9:75977896-75977918 CCACCGCGCCCGGCCAAGAGTGG + Intronic
1055959611 9:81808033-81808055 CCACCGCGCCTGGCCTATAGTGG + Intergenic
1056116493 9:83446358-83446380 CCACCGCGCCCGGCCAACAGAGG - Intronic
1056170814 9:83982374-83982396 CCACCGTGCCCGGCCGGAAGAGG - Intronic
1056638493 9:88350433-88350455 CCACTGTGCCTGGCCACAAAAGG - Intergenic
1056805636 9:89726673-89726695 CCACCACGCCTGGCAAGAATAGG + Intergenic
1057009332 9:91587973-91587995 CCACTGTACCTGGCCAAAAATGG - Intronic
1057063569 9:92026962-92026984 CCACCGTGCCTGGCCTAGAGAGG - Intergenic
1057093005 9:92277193-92277215 CCACCGTGCCTGGCCAAGCTGGG - Intronic
1057268294 9:93633184-93633206 CCACTGTGGCTTTCAAAAAGAGG - Intronic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1057774834 9:97999092-97999114 CCACCGCGCCCGGCCGAAAGTGG + Intronic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1057890014 9:98862901-98862923 CCACCGTGCCTGGCCACCAACGG + Intergenic
1057891959 9:98876287-98876309 CCACGGTGCCTGGCCATTAGAGG + Intergenic
1058145422 9:101405786-101405808 CCACCGTGCCTGGCCTAAAATGG - Intronic
1058182815 9:101818372-101818394 CCACTGCGCCTGGCCAATAGTGG + Intergenic
1058255662 9:102759651-102759673 CCACCATGCCTGGCCCAATGTGG - Intergenic
1058391251 9:104497957-104497979 CCACTGCGCCTGGCCAAATGTGG - Intergenic
1058621526 9:106888326-106888348 CCACCGCGCCCGGCCAAATGTGG + Intronic
1058680115 9:107433482-107433504 CCACCGTGCCCGGCCAAGAGTGG - Intergenic
1058739071 9:107924368-107924390 CCACCACACCTGGCCAAAAGAGG - Intergenic
1059134381 9:111790831-111790853 CCACCGTGCCCAGCCAAAAGTGG + Intronic
1059207443 9:112479986-112480008 CCACCGTGCCCGGCCAACATGGG + Intronic
1059536256 9:115083890-115083912 CCACCATGCCCGGCCAAATGAGG + Intronic
1059642584 9:116232039-116232061 CCACCGCACCTGGCCAACAGTGG + Intronic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060019767 9:120119002-120119024 GCCCAGTGCCTGGCACAAAGTGG + Intergenic
1060107358 9:120881432-120881454 TCACCGTGCCTGGCCCACAGGGG + Intronic
1060121612 9:120996104-120996126 CCACTGTGCCTGGCCAGAAGTGG + Intronic
1060123398 9:121018284-121018306 CCACCGTGCCCAGCCAAAATTGG - Intronic
1060294480 9:122333882-122333904 CCACTGTGCCTGGCCAACAATGG - Intergenic
1060336267 9:122726064-122726086 CCACAGTGCCTGGCCCAAAACGG - Intergenic
1060456056 9:123799195-123799217 TCACAGTGCCTGGCAAATAGTGG - Intronic
1060460332 9:123847127-123847149 CCACTGTGCCTGGCCATAAATGG + Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1060699331 9:125737177-125737199 CCACCGTACCTGGCCAGATGAGG + Intergenic
1060732135 9:126045486-126045508 CCACCGTGCCTGGCCACAGATGG - Intergenic
1060733293 9:126051091-126051113 CCACCGCACCTGGCCAAAATGGG - Intergenic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061692270 9:132343030-132343052 CCACCGCGCCCGGCAAAAAAGGG - Intronic
1061745901 9:132740207-132740229 ACACAGTGCCTGATAAAAAGTGG - Intronic
1061910934 9:133723473-133723495 CCACCATGCCTGGCAGAAGAAGG - Intronic
1061982373 9:134113578-134113600 CCACCGCGCCCGGCCAAAAGTGG + Intergenic
1062083935 9:134638909-134638931 CCACAGTGCCTAGCAGAGAGTGG - Intergenic
1062472134 9:136710910-136710932 CCACCGTGCCTGGCCACACCAGG - Intergenic
1062509140 9:136895219-136895241 CCACCGTGTCGGGCACACAGTGG + Intronic
1062550808 9:137085662-137085684 CCACCGCGCCTGGCCCCAAGGGG + Intergenic
1062611500 9:137376640-137376662 CCACCATCCCCGGCCAAAAGAGG - Intronic
1185498924 X:583192-583214 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1185691142 X:2156118-2156140 CCACCATGCCTGGCCTCAAGGGG - Intergenic
1185702851 X:2244056-2244078 CCACCGCGCCTGGCCACATGTGG + Intronic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1186072677 X:5839289-5839311 ACACCGTGCCCGGCAAAGATTGG + Intergenic
1186191700 X:7073104-7073126 GCACCCTGCCTGGCACACAGTGG + Intronic
1186327260 X:8493279-8493301 CCACCGTGCCCGGCCAAGATAGG + Intergenic
1186551794 X:10513794-10513816 CCACTGTGCCTGGCCAACAATGG + Intronic
1186647943 X:11527324-11527346 CCACTGTGCCTGGCAACAATTGG - Intronic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1187160990 X:16764984-16765006 CCACTGCACCTGGCCAAAAGTGG + Exonic
1187163084 X:16782181-16782203 CCACCGTGCCTGGCCAGAAATGG + Intergenic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187343004 X:18438349-18438371 CCACCATGCCTGGCCTGAAGAGG + Intronic
1187387005 X:18858046-18858068 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1187402410 X:18973290-18973312 CCACCGCGCCTGGCCTTAAGAGG + Intronic
1187502230 X:19849095-19849117 CCACCGTGCCTGGCCAGCTGTGG + Intronic
1187721265 X:22153269-22153291 CCACCGTACCTGGCCCTAAGTGG + Intronic
1188033654 X:25292589-25292611 CCACCGTGCCTGGCCTTAAATGG + Intergenic
1188206281 X:27363228-27363250 CCACCGTGCCCGGCCAAGACTGG + Intergenic
1188315269 X:28665776-28665798 CCACCATGCCCGGCTATAAGTGG + Intronic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1188921157 X:35979264-35979286 GCTCCGTGCCTGGCCAAGAGTGG + Intronic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189295668 X:39915793-39915815 CCACCGCGCCTGGCCAACATAGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189521140 X:41769659-41769681 CCACTGTGCCTGGCCCAAAGAGG - Intronic
1189820289 X:44864069-44864091 CCACCGTGCAGGGCCAACAGAGG + Intergenic
1190067295 X:47250172-47250194 CCATCGTGCCAGGCAGACAGTGG + Intergenic
1190087063 X:47404450-47404472 CCACCGCACCTGGCAGACAGAGG + Intronic
1190549266 X:51562486-51562508 CCACCGTGCCTGGCCTAAAATGG - Intergenic
1190692817 X:52926053-52926075 CCACCACGCCTGGCAAAACCTGG + Intergenic
1190736655 X:53259912-53259934 GCACTGTGCCTGGCATACAGAGG - Intronic
1190769985 X:53506143-53506165 CTACCTTGCCTGGCAAGAATAGG - Intergenic
1191056474 X:56246412-56246434 CAACAGTACCTGGCACAAAGAGG - Intronic
1191634985 X:63366463-63366485 CCACCGTGCCTGGCACTTTGTGG - Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1192120906 X:68454800-68454822 CCACCGAGCCTGGCCTAAAAAGG + Intergenic
1192372107 X:70522828-70522850 CCACCGCGCCTGGCCGACAGAGG + Intergenic
1193387187 X:80885651-80885673 CCACCATGCCTGGCAATCTGAGG + Intergenic
1193593166 X:83414684-83414706 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1194213634 X:91100060-91100082 CCACCGTGCCTGGCCATATTTGG + Intergenic
1194547701 X:95258012-95258034 CCACCGTGGATGGAGAAAAGGGG - Intergenic
1194587096 X:95748708-95748730 CCACCGTGCCTGGCCCCAAATGG + Intergenic
1194659486 X:96614130-96614152 CCACCGTGCCTGGCCAGTAGTGG - Intergenic
1194760270 X:97788221-97788243 CCACCATGCCTGGCAAATTTTGG - Intergenic
1195081818 X:101378369-101378391 CCACCGTGCCTGGCCAGTAAAGG + Intronic
1195376946 X:104237292-104237314 CCACCGTGCCTGGCCTCAGGTGG - Intergenic
1195873809 X:109516840-109516862 CCACCGCGCCTGGCCAACATAGG - Intergenic
1196076590 X:111584856-111584878 CCACCGTGCCGGGCAAATGAAGG - Intergenic
1196150430 X:112367651-112367673 CCCCAGTGCCTGGCATATAGTGG - Intergenic
1196193047 X:112813983-112814005 CCACTGCGCCTGGCAAACAGAGG - Intronic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1196895961 X:120335851-120335873 TCACCGTGCCTGGCTAGATGTGG + Intergenic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197834238 X:130677797-130677819 CCATCATGCCTGGCAAAACTGGG - Intronic
1197865127 X:131009428-131009450 GCACAGTGCCTGGCACAGAGTGG - Intergenic
1197916707 X:131543519-131543541 CCACGGTGCCTGACATAGAGTGG - Intergenic
1198117742 X:133560449-133560471 CCACCATGCCCGGCCAAAATAGG - Intronic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198473885 X:136976765-136976787 CCACCGTGCCTGGCCAACGCAGG + Intergenic
1198744339 X:139874345-139874367 CCACCGCGCCTGGCACAATCAGG + Intronic
1198745501 X:139886301-139886323 CCACCGCGCCTGGCCACAACTGG - Intronic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1200278504 X:154756945-154756967 CCACCGTGGCTGGCCCAATGTGG - Intergenic
1200284921 X:154811388-154811410 CCACCGTGCCTGACTAAAGATGG - Intronic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1201294313 Y:12450658-12450680 CCACCATGCCCGGCCAAAAGTGG + Intergenic
1201450786 Y:14111651-14111673 CCACCATGCCTGGCAAATTTTGG + Intergenic