ID: 978361245

View in Genome Browser
Species Human (GRCh38)
Location 4:107932490-107932512
Sequence TGGCCCCCATGTTAGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978361238_978361245 10 Left 978361238 4:107932457-107932479 CCTTCCACCAGCTGTGACCTCGG 0: 1
1: 1
2: 1
3: 21
4: 220
Right 978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 129
978361241_978361245 3 Left 978361241 4:107932464-107932486 CCAGCTGTGACCTCGGAGAGAAA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 129
978361240_978361245 6 Left 978361240 4:107932461-107932483 CCACCAGCTGTGACCTCGGAGAG 0: 1
1: 0
2: 0
3: 19
4: 181
Right 978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 129
978361243_978361245 -7 Left 978361243 4:107932474-107932496 CCTCGGAGAGAAACTTTGGCCCC 0: 1
1: 0
2: 0
3: 19
4: 71
Right 978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 129
978361237_978361245 11 Left 978361237 4:107932456-107932478 CCCTTCCACCAGCTGTGACCTCG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 129
978361236_978361245 15 Left 978361236 4:107932452-107932474 CCTTCCCTTCCACCAGCTGTGAC 0: 1
1: 1
2: 8
3: 58
4: 409
Right 978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 129
978361235_978361245 25 Left 978361235 4:107932442-107932464 CCAAAAGTAGCCTTCCCTTCCAC 0: 1
1: 0
2: 0
3: 21
4: 177
Right 978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978361245 Original CRISPR TGGCCCCCATGTTAGAAAGA GGG Intronic
901772672 1:11538434-11538456 TGGTACCCCTCTTAGAAAGAAGG - Intergenic
903764068 1:25721727-25721749 AGGCATCCATATTAGAAAGAAGG - Intronic
904266559 1:29321670-29321692 TGGCCCCCATTTTACAGAGAAGG - Intronic
905197036 1:36287847-36287869 TGTCCCCCAGGGGAGAAAGACGG - Intronic
906125411 1:43424249-43424271 TGGCTCCAATGTCAGCAAGAAGG - Exonic
906331853 1:44892034-44892056 TGGCCCCTATTTTATAAAGAAGG + Intronic
910066655 1:83161422-83161444 TGCCACTCATGTAAGAAAGAAGG - Intergenic
910342577 1:86204465-86204487 TGGCCCGTATGTTAGTAAGGGGG + Intergenic
910865836 1:91787428-91787450 TCGCTCCCATGTTAGATACAGGG - Intronic
915138395 1:153750218-153750240 TGGCCCCCCTGTTGGAAGGCAGG - Intronic
917362078 1:174187656-174187678 TTGCCCCCATGTTTTAAAAAGGG - Intronic
920420501 1:205830054-205830076 TGGCCCCTCTTTTACAAAGATGG - Intronic
921254597 1:213328076-213328098 TGTCGCCCATGTTAGAAGGTAGG + Intergenic
922509042 1:226147547-226147569 TCCTCCCCATTTTAGAAAGATGG + Intronic
923466913 1:234256702-234256724 TGGGTCCCATGTTAGACAAATGG - Intronic
924590603 1:245400542-245400564 TGGCCCCCATGCTGGATAGCAGG - Intronic
1062944774 10:1451873-1451895 TCGCCCACATGTGAGACAGATGG + Intronic
1063486046 10:6422318-6422340 TGGTCCTCATTTTAGAAAGGAGG + Intergenic
1064625151 10:17253857-17253879 TGGCCCCTCTGTTAGAATGGGGG - Intergenic
1068412162 10:56670150-56670172 TGGCCCAAATGCTAGAAAGCAGG + Intergenic
1068767133 10:60776266-60776288 TGCCCCCCATGGTAGAATGTAGG - Intergenic
1069426349 10:68291796-68291818 TGGCCCCCATGGTAGGATGGAGG - Intronic
1073215874 10:101835981-101836003 TGGCTCCCTTCTTAGAAAGCTGG + Intronic
1073550014 10:104390500-104390522 TGCCCCCAATTTTACAAAGAAGG - Intronic
1076350310 10:129810953-129810975 TGCCCCCCATGTTTGTAATAGGG + Intergenic
1076560406 10:131359626-131359648 TGGAGCCCATGCTAGAGAGAGGG + Intergenic
1077991974 11:7420190-7420212 TGGCCTCCATGTAATAAAGAGGG - Intronic
1079188699 11:18259815-18259837 TGGTGTACATGTTAGAAAGAAGG + Intergenic
1085254640 11:75165529-75165551 TGGACCCCATGTTAGAACATGGG - Intronic
1089311794 11:117562904-117562926 TTGCCTCCACTTTAGAAAGAAGG - Intronic
1091145251 11:133273712-133273734 TGGCCCCCATTTTAGGAAAGAGG - Intronic
1095991262 12:48036178-48036200 TGGCCCCGATATAGGAAAGAAGG + Intergenic
1096684398 12:53278172-53278194 TGGCCCCTATTTTAGAGATAAGG - Intronic
1097275318 12:57809354-57809376 TGACCCCCATGTTAGATATGGGG + Intronic
1098357918 12:69628527-69628549 TTTCCCCCATTTTACAAAGAAGG - Intergenic
1102492026 12:113295218-113295240 TGGCCCCCTTGTTTTACAGAGGG - Intronic
1102513087 12:113428804-113428826 TGGGCCTCATGGTAGCAAGATGG + Intronic
1105274229 13:18905546-18905568 TGGCCAGCATGGTAGAAAGGTGG + Intergenic
1105710653 13:23005556-23005578 AGGCCCCAATGTTATAGAGATGG - Intergenic
1110777671 13:79428678-79428700 TGGCAGCCATGGTAGAAAGGAGG + Intergenic
1120029086 14:79619914-79619936 TGGTCCCCATGTCAGAACTAAGG - Intronic
1120526735 14:85585105-85585127 GGGCCACCATTTTACAAAGAGGG - Intronic
1121491953 14:94367451-94367473 TGGCCCCCATTTTAGAAAATAGG + Intergenic
1121943140 14:98092406-98092428 TGCCCCCAGGGTTAGAAAGAGGG + Intergenic
1124157253 15:27236777-27236799 TGGGACCCATGTTAAAAAAATGG - Intronic
1127721063 15:61699816-61699838 GGGGCCCCATGTTACAAACATGG + Intergenic
1128312032 15:66636817-66636839 TGGCGCCCATGTCAGACTGAAGG - Intronic
1128985687 15:72219264-72219286 TGCTCCTCATGTTAGAAAAAGGG + Intronic
1131111921 15:89769944-89769966 TGGTTCCCCTGTTAAAAAGAGGG - Intronic
1131542136 15:93283461-93283483 TGGCCGCCATATTGGAAAGTTGG + Intergenic
1131909377 15:97180110-97180132 TGACCCCCATTTTACAAATATGG + Intergenic
1134356380 16:13486066-13486088 AGGCTTCCATGTTAGAAACAGGG + Intergenic
1134605746 16:15569880-15569902 AGGCCCCCATGTTAGAAGGATGG - Intronic
1135933596 16:26760382-26760404 TGGCCCCCATGCTTGAAATGAGG - Intergenic
1137972664 16:53001271-53001293 TGGTCCTTATGTGAGAAAGAGGG + Intergenic
1139278388 16:65749069-65749091 TAGCCCCTATGTTTCAAAGATGG - Intergenic
1140778588 16:78273566-78273588 TGGCAGCCATGTGAGAAAGGAGG + Intronic
1145269192 17:21395724-21395746 TTGCCCCCATGTTACAGATAGGG + Intronic
1147582927 17:41637026-41637048 TGGCCCCCATGGAAGACAAAGGG + Intergenic
1148989181 17:51650678-51650700 TGCACCCCATGAAAGAAAGATGG + Intronic
1149353148 17:55812356-55812378 TTTCCCCCATGGTACAAAGAAGG + Intronic
1151167642 17:72219169-72219191 TGTCCCCAGTGCTAGAAAGAAGG - Intergenic
1151222006 17:72619980-72620002 TGGCACCCATGTTTGACAAAGGG + Intergenic
1151255409 17:72872747-72872769 TGGCCACCAGGTTAGAATTATGG + Intronic
1154016282 18:10620737-10620759 TGGCCTCCCTGTGAGAAACATGG + Intergenic
1154189232 18:12214913-12214935 TGGCCTCCCTGTGAGAAACATGG - Intergenic
1154465930 18:14642798-14642820 TGGCCAGCATGGTAGAAAGGTGG + Intergenic
1155292560 18:24356462-24356484 AGGCCCCTGTGTTAGAAAGGGGG + Intronic
1155505417 18:26528285-26528307 TGGGCCCCATGTGAGGAGGATGG + Intronic
1160412392 18:78683796-78683818 TGGCCCCCACATCAGACAGATGG + Intergenic
1161007270 19:1942792-1942814 GGGCCCCCAGGTTTGAAAGGGGG + Intronic
1163324335 19:16593414-16593436 TGGACCACATGTGAGAAAGCGGG - Intronic
1164727765 19:30478113-30478135 TGGCTCACATTTAAGAAAGATGG + Intronic
925704398 2:6670109-6670131 TGGCCCCCATCTTAAGCAGATGG + Intergenic
925956129 2:8966851-8966873 TAGTCCCCATGTTAGACACATGG - Intronic
928157430 2:28889345-28889367 TGGACTCAATGGTAGAAAGATGG + Intergenic
928232165 2:29507795-29507817 TGGCCCTCATGGTACAGAGAGGG + Intronic
929593391 2:43161078-43161100 TGGCCTCCATTTTACAGAGAGGG + Intergenic
929947210 2:46380550-46380572 TGCCCCCCATGGAAGAGAGAGGG - Exonic
933861152 2:86469618-86469640 TGGACCACATGTGTGAAAGAAGG + Intronic
934090856 2:88549511-88549533 TGGCCCCCATTTTACAGAGGAGG - Intergenic
935329398 2:101965485-101965507 TGTCCTCCAAGTTAGAAAAATGG + Intergenic
939214282 2:139215981-139216003 TGCCCTTCCTGTTAGAAAGATGG - Intergenic
943614965 2:190082164-190082186 TGGGATCCATGTTAGAAAAATGG - Intronic
946034878 2:216733706-216733728 TGGTACCTATGCTAGAAAGAGGG - Intergenic
946746128 2:222847692-222847714 AGGTCCCCATGTCAGAAAGATGG - Intergenic
947883763 2:233545595-233545617 TGGCCTCCATGCTAGAAGAAAGG + Intronic
1172332095 20:34082265-34082287 TGTCCCCCATGTTTCACAGATGG - Intronic
1176808654 21:13515796-13515818 TGGCCAGCATGGTAGAAAGGTGG - Intergenic
1181961346 22:26624055-26624077 TGGCTACCATATTAGATAGAAGG + Intronic
949855746 3:8459442-8459464 TGGGCCCAGTGTTAGCAAGAAGG - Intergenic
950261776 3:11547268-11547290 TTGCCCCCATTTTACAAAGTAGG - Intronic
950557482 3:13704253-13704275 GGGCCCCCATGTTAGGATGCTGG + Intergenic
955458579 3:59153167-59153189 TGGCACTTATGTTTGAAAGAGGG - Intergenic
955476945 3:59346986-59347008 GGGCACCCATATCAGAAAGATGG - Intergenic
957345601 3:78957460-78957482 GGGCCCCCATGTTAAAAAGCTGG - Intronic
958259479 3:91364018-91364040 TGGCACCCTCTTTAGAAAGAGGG + Intergenic
958954793 3:100455895-100455917 TGGCTCCCCTGTTTGAAAAAGGG + Exonic
960066791 3:113382908-113382930 TGGTCACCATGTGTGAAAGAGGG + Intronic
960383641 3:116993755-116993777 TGGCCCTCATGCTAGAAAGGTGG + Intronic
968186883 3:196639274-196639296 CGGACCCTGTGTTAGAAAGAAGG - Intergenic
968946882 4:3669496-3669518 TGGCCCCCATTTTAAACCGATGG - Intergenic
970889698 4:21029177-21029199 TTACCCTCATCTTAGAAAGAAGG - Intronic
971453796 4:26824644-26824666 TGACCCCACTGTTAAAAAGAAGG - Intergenic
972076550 4:35096636-35096658 TTGCCCCCATTTCAGACAGATGG - Intergenic
978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG + Intronic
979974070 4:127174072-127174094 TGGTGCCCATGTGAGAAATAAGG - Intergenic
982544057 4:156710797-156710819 TGACCCTCCTGTTAGAATGAGGG - Intergenic
985000692 4:185479571-185479593 TCGGCCCCATGTCAGATAGAGGG + Intergenic
985951794 5:3227724-3227746 TGGCCCCTATTTTAATAAGATGG + Intergenic
986847164 5:11768841-11768863 TTCCCCACATGTTTGAAAGATGG - Intronic
998059366 5:139107230-139107252 TGCCTCCCATGTCAGAAGGAGGG - Intronic
1001890536 5:175334488-175334510 TGGCCCCCATTTTAGGAATGTGG + Intergenic
1006925592 6:37652667-37652689 TTACCCCCATTTTACAAAGAAGG + Intronic
1007945631 6:45824415-45824437 TTGTCCCCATTTTAGAAAGGAGG - Intergenic
1013919379 6:115382876-115382898 TGCCACCAATGTTAAAAAGAGGG - Intergenic
1014799045 6:125757222-125757244 TGACTCCCATGAGAGAAAGACGG - Intronic
1014847394 6:126295067-126295089 TGGACCCCAGGTAAGAAAAATGG - Intergenic
1016440504 6:144078567-144078589 TGGACCCATTGATAGAAAGAGGG - Intergenic
1017224732 6:152007722-152007744 TGGCCCCCATGTCATTGAGATGG + Intronic
1017903614 6:158739603-158739625 AGACCCCCATCTCAGAAAGATGG - Intronic
1018036706 6:159888220-159888242 TCCCCTCCGTGTTAGAAAGATGG - Intergenic
1021799698 7:24292237-24292259 TGGCTGCCATATTAGACAGAGGG - Intergenic
1023053387 7:36272781-36272803 TGGCCCCCATGGAAGAAGAATGG + Intronic
1024629439 7:51235255-51235277 TGGCCCCCAGGTTTGGAGGACGG + Intronic
1027277454 7:76573339-76573361 TGCCACTCATGTAAGAAAGAAGG + Intergenic
1031666438 7:124489420-124489442 TGGATCCCATGTTACAATGAGGG + Intergenic
1038269578 8:26064350-26064372 TGGACCCCCTGTTAGCAAGAGGG - Intergenic
1040290724 8:46122698-46122720 AGGCCCCCATGTGGGAAAAAGGG - Intergenic
1042742394 8:72065114-72065136 TGGCCTGGATGTTATAAAGATGG - Intronic
1043246757 8:78013051-78013073 GGGCCCCCATTACAGAAAGATGG + Intergenic
1046778419 8:118188970-118188992 TGGCCACCATCTTAGAGAGATGG + Intergenic
1048979201 8:139694110-139694132 TGGCCCCAATCTTAGCAAGGGGG - Intronic
1050126508 9:2361735-2361757 TGGCTCCCATGATAACAAGAGGG - Intergenic
1055588032 9:77777093-77777115 TGGCCCCCATGTTGAAAACCAGG - Intronic
1056431879 9:86535853-86535875 TGTCCCCCACTTTAGAAAGAGGG + Intergenic
1061304374 9:129724023-129724045 TGGCCCCCACTTTAGTTAGAAGG + Intergenic
1203770026 EBV:45194-45216 TGGCCCCCATGTTTGGACTAAGG - Intergenic
1185574702 X:1162200-1162222 TGACCCCCTTTTTAGAAAGAGGG - Intergenic
1186683583 X:11900899-11900921 TGACCCCCATCGCAGAAAGAGGG + Intergenic
1187262600 X:17700888-17700910 TACCCTTCATGTTAGAAAGAAGG + Intronic
1190973278 X:55373894-55373916 TGGCACCCAAGTTGGAAAGAAGG - Intergenic
1195488102 X:105433660-105433682 TTGTCCCCATTTTAGAAAGAGGG + Intronic
1198138162 X:133775498-133775520 GGGCCCTAATGTTAGTAAGATGG - Intronic