ID: 978369439

View in Genome Browser
Species Human (GRCh38)
Location 4:108015736-108015758
Sequence CTATGTTTCTTGAAGTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978369436_978369439 -7 Left 978369436 4:108015720-108015742 CCATCCAGGGACAGGCCTATGTT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 978369439 4:108015736-108015758 CTATGTTTCTTGAAGTGTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 167
978369432_978369439 13 Left 978369432 4:108015700-108015722 CCATGGTAACATGGAGGGGTCCA 0: 1
1: 0
2: 0
3: 13
4: 111
Right 978369439 4:108015736-108015758 CTATGTTTCTTGAAGTGTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 167
978369431_978369439 14 Left 978369431 4:108015699-108015721 CCCATGGTAACATGGAGGGGTCC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 978369439 4:108015736-108015758 CTATGTTTCTTGAAGTGTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978369439 Original CRISPR CTATGTTTCTTGAAGTGTGT AGG Intronic
900516493 1:3084698-3084720 CTGTGTTTTTTGAAGCGGGTGGG - Intronic
902620425 1:17647577-17647599 CTATGTGCCTTGCAGTGTGCTGG + Intronic
904048875 1:27626200-27626222 CAATGTTTCTGGCAGGGTGTGGG - Intronic
904844444 1:33398552-33398574 CTATGTATCTTAAAGTATCTGGG + Intronic
906618370 1:47251915-47251937 CTTTGTGTCTTTCAGTGTGTTGG - Exonic
908285889 1:62600514-62600536 TTATTTTTATTTAAGTGTGTTGG - Intronic
908679550 1:66645232-66645254 CTATGTTTCTGGGACTGTGCCGG - Intronic
908939071 1:69410207-69410229 CTCTGTTTGGTGAAGAGTGTGGG + Intergenic
909506871 1:76401880-76401902 CTCTGTTTCTGGAAGCATGTTGG - Intronic
909869415 1:80720564-80720586 TTATGTTTATTGATTTGTGTGGG + Intergenic
909940437 1:81604900-81604922 ATATCTTTCTCAAAGTGTGTGGG - Intronic
912040476 1:105383639-105383661 CTATGATTCATGAAGGGTGAGGG + Intergenic
915733459 1:158070053-158070075 CTATGTTGGTGGCAGTGTGTGGG + Intronic
915769148 1:158400513-158400535 GTATGTTTCTGGAACTGTGAAGG + Intergenic
916424034 1:164663740-164663762 CAAAGTATGTTGAAGTGTGTTGG + Intronic
916463574 1:165049997-165050019 ATATGTTTCTTGGAGTTTGAGGG - Intergenic
919190435 1:194210050-194210072 ATATGTGTATTGATGTGTGTGGG + Intergenic
919321851 1:196051989-196052011 CTATGTTTCTTTAATTATTTTGG + Intergenic
920741575 1:208586070-208586092 CTATGTGTCCTGTAGTGTGCTGG + Intergenic
921035374 1:211372948-211372970 GTAAGTTTCTTGAAGTTTTTGGG + Exonic
922184249 1:223259916-223259938 CTGTGTATTTTGAAGTGTGGTGG - Intronic
922955157 1:229593538-229593560 ACATGTTTCTGGAAGTGGGTGGG - Exonic
1062850829 10:741437-741459 CTATTTGTATTAAAGTGTGTGGG - Intergenic
1065642017 10:27792853-27792875 CTATGTGCCGTGAACTGTGTAGG - Intergenic
1067166545 10:43870103-43870125 CCAGGTTCCTTGAAGTGGGTGGG - Intergenic
1067798530 10:49339182-49339204 CTAAGTTACTTGAAGTTAGTTGG - Intergenic
1067853911 10:49774780-49774802 CTATATTATATGAAGTGTGTGGG + Intergenic
1068568559 10:58603505-58603527 CTATGTATCTTCAAGTAAGTTGG + Intronic
1069776372 10:70929586-70929608 CTATGTTGCACGATGTGTGTGGG + Intergenic
1069925420 10:71847126-71847148 CTATGAGAGTTGAAGTGTGTTGG - Intronic
1070102227 10:73399184-73399206 CTTTGTTTCATGCAGTGTTTTGG - Intronic
1071155879 10:82688357-82688379 CGATGTTTGTTAAAGTGTTTTGG + Intronic
1073167201 10:101466315-101466337 TTATATTTCTTTAAGTGTTTAGG + Intronic
1078341450 11:10500381-10500403 CTGTGTGTTTTGAGGTGTGTGGG - Intronic
1080089837 11:28333673-28333695 CTATGTTCTTTGAAGTTTCTAGG + Intergenic
1080797907 11:35582477-35582499 CTATGTTTCCTGATTTATGTAGG + Intergenic
1084604557 11:70164985-70165007 CTCTGTTACTTTAAGTCTGTGGG - Intronic
1087235731 11:95716484-95716506 CTATGTATCTTGCATTATGTTGG - Intergenic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1095261299 12:40103028-40103050 GTATGTTTCTGGAAGTGAGATGG + Intronic
1096907969 12:54953227-54953249 CTATGTTATTTTAAGTGTTTTGG - Intronic
1099282148 12:80664097-80664119 CTGTGTTACTAGAAGTGTATTGG + Intronic
1101065631 12:101017390-101017412 CTATGATTCAAGAAGAGTGTGGG + Intronic
1106630415 13:31466396-31466418 CTATGTTTCATTTTGTGTGTTGG + Intergenic
1111916051 13:94361511-94361533 AGATGTTTCTTGAAGTGAATGGG + Intronic
1114700736 14:24675691-24675713 CTATGTTTGTTGAGGTATTTAGG + Intergenic
1115387103 14:32810521-32810543 CTATGTTTTTTAACGTGTCTAGG + Intronic
1116348091 14:43822433-43822455 CTATGTTTCTCAAGGTGAGTGGG - Intergenic
1117539690 14:56734533-56734555 CTATGTTTCTAAAATGGTGTAGG + Intergenic
1117709657 14:58513153-58513175 CTATGTTTCTACAAGGCTGTTGG + Intronic
1117825457 14:59697575-59697597 CTATTTTTCTTGAAATATTTGGG - Intronic
1118069891 14:62234859-62234881 CCATGTTTCTTTAAGTATTTGGG - Intergenic
1118842203 14:69521789-69521811 CTATTTTTCTTGAGGTATCTGGG - Intronic
1125444064 15:39734146-39734168 CTTTTTTTCTTGAAGCATGTAGG - Intronic
1125737659 15:41939149-41939171 ATTGCTTTCTTGAAGTGTGTGGG - Intronic
1126648943 15:50902568-50902590 TTATCTTCCTTGAAGTGTGAAGG + Intergenic
1131030605 15:89183283-89183305 CTATGTTTCTTTTAGTCTGTAGG + Intronic
1133586952 16:7204905-7204927 CTATGTCTCTTGCACTGTCTGGG + Intronic
1136041089 16:27579486-27579508 TTATATTACTTGAAGTGTCTAGG + Intronic
1140988721 16:80186875-80186897 CTATGTTTCCTAAAGTTTGAGGG + Intergenic
1143671699 17:8400727-8400749 CTATGTGTGTTTATGTGTGTTGG + Intergenic
1146922908 17:36725512-36725534 CTATTTGTCTTCATGTGTGTTGG - Intergenic
1148572187 17:48678798-48678820 CTATGCTTCTGGAAGGGTGCAGG - Intergenic
1149108596 17:52998203-52998225 CTATGTTTCCTCAAGTCTCTGGG - Intergenic
1153052786 18:915638-915660 TTATGTTCCCAGAAGTGTGTTGG - Intergenic
1155012081 18:21789291-21789313 CTGTGTTTCTTGGTGGGTGTCGG + Intronic
1155871265 18:31031495-31031517 ATATGTTTATTCAGGTGTGTTGG - Intronic
1158073308 18:53499015-53499037 CTATATTGCTTGAACTGTCTGGG - Intronic
1159924155 18:74251772-74251794 CAATGTTTCTTCATGTGTTTTGG - Exonic
1160134603 18:76261837-76261859 CTCTGTTTCTGGAATTATGTGGG + Intergenic
1160376543 18:78418044-78418066 CTATGTTTCTTGAAGGAAGTTGG + Intergenic
1166339671 19:42129928-42129950 ATCTGTTTCTTGTATTGTGTTGG - Intronic
1167771846 19:51525673-51525695 GTATGGTGCTTGTAGTGTGTTGG - Intronic
1167838845 19:52097257-52097279 GTATGTTTCTTTGTGTGTGTTGG - Intergenic
1168312074 19:55465354-55465376 CCTTGTTTCTGGAAGGGTGTTGG + Intergenic
1168373364 19:55855053-55855075 CCATGTTTCCTGGAGTGTTTTGG + Intronic
928336994 2:30406693-30406715 CTGTGTGTCTTCAAATGTGTAGG - Intergenic
929473022 2:42215477-42215499 CATTTTCTCTTGAAGTGTGTTGG + Intronic
930471080 2:51814462-51814484 CTATATTTCTTTGAGTATGTTGG - Intergenic
931679434 2:64732044-64732066 TTAGGTTTCTTGACGTGTTTAGG - Intronic
931755616 2:65371619-65371641 CTATGTTTCTTAAAGTGTAACGG + Intronic
931970085 2:67576357-67576379 TTATGTCCCTTGAATTGTGTAGG - Intergenic
933479843 2:82842010-82842032 TTATGTTTATTGAAGTTTATTGG - Intergenic
933668608 2:84985476-84985498 TGATGTTTCCTGAAGGGTGTGGG + Intronic
933834829 2:86237342-86237364 CTCTGTTCCTTCTAGTGTGTTGG - Intronic
939005698 2:136784164-136784186 TTATTTTTCTTGCAGTTTGTAGG + Intronic
940486756 2:154305737-154305759 CTATCTGTCTTGAACTGTCTGGG + Intronic
941593215 2:167445626-167445648 TTGTGTTTCTTGAATTTTGTTGG + Intergenic
941881412 2:170484057-170484079 CTATGTTTCTTCACATGTTTGGG + Intronic
942300049 2:174552408-174552430 CTGCGTTTCTTTCAGTGTGTTGG - Intergenic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
943970662 2:194402185-194402207 CTAAGTTTCAGGAATTGTGTGGG - Intergenic
945831307 2:214789619-214789641 TTATGTTTGTTGAATTGAGTTGG - Intronic
946809874 2:223512410-223512432 CTATGTGTCTAAAAGTGTTTTGG - Intergenic
947991149 2:234488483-234488505 CTATGTAATTTGAAGTGTGCTGG - Intergenic
948278269 2:236726735-236726757 CTGTGGTTCAAGAAGTGTGTCGG - Intergenic
1169505338 20:6204788-6204810 CAATGGTTGTTCAAGTGTGTGGG + Intergenic
1169652160 20:7881293-7881315 CTAAGTTTCTTGAAATATGTTGG - Intergenic
1170536063 20:17342213-17342235 CAATGTTTCTTGGAATGTGTGGG - Intronic
1175396798 20:58670041-58670063 CTAGGTTTTTTGGAGTATGTGGG - Intronic
1181264653 22:21623909-21623931 CCTGGTTTCTTGAAGTGTGCTGG + Exonic
949175086 3:1051846-1051868 TTCTGTTTCTTGCTGTGTGTTGG + Intergenic
949783690 3:7717631-7717653 CTTTGTTTCTTGATATCTGTTGG + Intronic
949818915 3:8093894-8093916 GTGTGTTTGTTTAAGTGTGTGGG - Intergenic
950412083 3:12845389-12845411 GGATGTTACTTGGAGTGTGTGGG + Intronic
952855643 3:37768744-37768766 CTATGTTTGTTGAATTGGCTTGG - Intronic
954441485 3:50524699-50524721 CTGAGTTTCTTGGAGGGTGTGGG - Intergenic
955924187 3:63989794-63989816 CTATGTTTCATTTATTGTGTAGG + Intronic
956385578 3:68714925-68714947 GTATGTTTCTTTCAGTGTCTTGG + Intergenic
957204487 3:77177975-77177997 TTATGTGTCTAGAAGTGTTTAGG + Intronic
957351274 3:79024543-79024565 CTTTGTTTCTTCAAGTGCTTTGG - Intronic
960879843 3:122333090-122333112 GTTTGTTTCTTGAAGTGTTCTGG - Intronic
961570440 3:127793861-127793883 CAAGTCTTCTTGAAGTGTGTTGG + Intronic
963410735 3:144924049-144924071 CTATGCTTCTTGAAAGATGTAGG - Intergenic
964979251 3:162659030-162659052 CTATGTCTATCAAAGTGTGTAGG + Intergenic
967621306 3:191637768-191637790 CTATGTTTATTGAATTATATTGG - Intergenic
972113069 4:35590684-35590706 CTATGTTTCATGAAGTATAGTGG + Intergenic
974580696 4:63796911-63796933 CTATGTTCCTGGTACTGTGTAGG + Intergenic
975071734 4:70148268-70148290 TTATGTTTTTTAAACTGTGTTGG + Intronic
976583051 4:86762641-86762663 CAATGTTTCTTGAAGATTGTTGG - Intronic
978369439 4:108015736-108015758 CTATGTTTCTTGAAGTGTGTAGG + Intronic
978436359 4:108688985-108689007 CTGTGGGACTTGAAGTGTGTTGG - Intergenic
985081511 4:186269924-186269946 TTATGTTTCTTGAAGATTTTTGG - Intronic
985963069 5:3317839-3317861 ACATTTTTCTTAAAGTGTGTTGG + Intergenic
986010124 5:3706597-3706619 CTCTGTTTGGTGATGTGTGTTGG + Intergenic
987538625 5:19223414-19223436 TTATGTTTCATGAAATGTTTGGG - Intergenic
987948112 5:24640794-24640816 CAATGTCTCTTAAAGTGTATAGG + Intronic
989115310 5:37946795-37946817 TTTTGTTTCTTGAAGTCTGGTGG + Intergenic
990015257 5:51053297-51053319 CTTTATTTCTTGAGGTGGGTGGG + Intergenic
1000547162 5:162617667-162617689 CTATGTATTTTGAATTGTGAAGG + Intergenic
1000602863 5:163296075-163296097 CTCTGTTTCTTGAATTGGCTGGG - Intergenic
1000788387 5:165574215-165574237 CTTATTTTCTTTAAGTGTGTGGG + Intergenic
1000865595 5:166511017-166511039 CCTTGTTTCTTGAAGAGTATTGG - Intergenic
1005020778 6:21416544-21416566 CAATGTTCCTTGAAGAGTGGAGG + Intergenic
1005038462 6:21579469-21579491 GTAAGTTTCTTGTAGTGTTTGGG - Intergenic
1005146588 6:22698193-22698215 CTATGTTTCTTGTACTATCTAGG - Intergenic
1008359735 6:50601426-50601448 CTTTGTATCTTGAAGTATATAGG - Intergenic
1009851631 6:69206878-69206900 CTTTCTTTCTTGAAGGGTCTGGG + Intronic
1010190791 6:73194338-73194360 CAATATTTCTTTAAATGTGTTGG + Intronic
1011036499 6:82982431-82982453 CTATGTTTCTTTTAATCTGTAGG + Intronic
1011889460 6:92138950-92138972 CTGTGTTTCTTGAAGTCTTTAGG + Intergenic
1013521739 6:110939755-110939777 CTTCCTTTCTTGAAATGTGTTGG + Intergenic
1014812674 6:125904066-125904088 CACTGTTTCCTGAAGTGTGGTGG - Intronic
1015381939 6:132579786-132579808 CCATGCTGCTTGAAATGTGTAGG - Intergenic
1017486633 6:154908203-154908225 CTATGTTTCTAGTAATCTGTAGG - Intronic
1023357296 7:39380049-39380071 CTATATTTCTTCAATTGGGTTGG - Intronic
1024161962 7:46685273-46685295 ACATTTTGCTTGAAGTGTGTGGG - Intronic
1032821492 7:135528214-135528236 CTCTGTTTCCTAAAGTATGTGGG + Intergenic
1034625113 7:152486536-152486558 CAATGTTTCTTAAAGTATGGTGG - Intergenic
1036975011 8:13401007-13401029 AATTGTTTCTTGTAGTGTGTTGG + Intronic
1041496053 8:58486405-58486427 CAGTTTTTCTTGGAGTGTGTTGG - Intergenic
1041625416 8:60020522-60020544 CTCTGTTTCCTGAAGTGTGGGGG - Intergenic
1044215605 8:89606495-89606517 CTTTGTTTCTGCAAGTTTGTGGG - Intergenic
1044410664 8:91879082-91879104 TTATTTTTCTTGAAGTAAGTAGG + Intergenic
1046830943 8:118745248-118745270 CTATGTTTGTTGAAGGTTGAGGG + Intergenic
1052133650 9:24883363-24883385 ATGTGTTTCTGTAAGTGTGTGGG + Intergenic
1052277154 9:26689848-26689870 ATTTGTTTCTTAAAGTGTTTTGG - Intergenic
1052841695 9:33296961-33296983 CTATGTTTCAAGAGCTGTGTGGG - Intronic
1057091604 9:92263068-92263090 CTATTTTTATTGAACTGTTTGGG - Intronic
1058142225 9:101369122-101369144 GTAAGTTTCTTTCAGTGTGTGGG - Intronic
1058413373 9:104759455-104759477 CTATGTTTCTTGCATTATGAAGG + Exonic
1058559755 9:106213669-106213691 CTATGTATGATGAATTGTGTGGG - Intergenic
1059187949 9:112293866-112293888 CTTAGTTTCTTGAATTGTGTTGG - Intronic
1059763267 9:117359603-117359625 ATATGGTTCTTGAAATCTGTGGG + Intronic
1186302272 X:8213148-8213170 CTATTGTTCTTGAAGGGTCTTGG - Intergenic
1186610898 X:11137247-11137269 CTGAGTTTCCTGAACTGTGTTGG - Intergenic
1187310278 X:18135198-18135220 CTAGCTTGCTTAAAGTGTGTTGG + Intergenic
1188184425 X:27096261-27096283 CTATGTTCGTTAAAGTTTGTTGG - Intergenic
1191190038 X:57656828-57656850 CCATATCTCTTGAAGTGTTTTGG + Intergenic
1193030223 X:76890008-76890030 TTATGTTTATTGATTTGTGTAGG - Intergenic
1196471260 X:116031260-116031282 CTATGTTTTCTGAAGTCTTTGGG + Intergenic
1197449463 X:126594060-126594082 CTATGTTTGCTGAAGTATATGGG + Intergenic
1198442470 X:136676179-136676201 CTATGTTTCTAGATGTGGGCAGG + Intronic
1200965050 Y:9028010-9028032 GTATGTTTCTGTAAGAGTGTTGG - Intergenic
1201251199 Y:12059414-12059436 CTTTGTTTCTTGATCTTTGTTGG - Intergenic
1202148061 Y:21820763-21820785 GTATGTTTCTGTAAGAGTGTTGG + Intergenic