ID: 978370957

View in Genome Browser
Species Human (GRCh38)
Location 4:108029228-108029250
Sequence CTGTATGAACGGAGATGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978370957_978370961 4 Left 978370957 4:108029228-108029250 CCGTGCCATCTCCGTTCATACAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 978370961 4:108029255-108029277 ACCTTGAAGCTTCAAGCATCTGG 0: 1
1: 0
2: 1
3: 15
4: 112
978370957_978370963 7 Left 978370957 4:108029228-108029250 CCGTGCCATCTCCGTTCATACAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 978370963 4:108029258-108029280 TTGAAGCTTCAAGCATCTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978370957 Original CRISPR CTGTATGAACGGAGATGGCA CGG (reversed) Intronic
903946433 1:26966786-26966808 CTGGATGAATGGAGATGACTGGG + Intergenic
904987476 1:34563750-34563772 CTGTATGGATGGAGAAGTCATGG - Intergenic
909882134 1:80892739-80892761 CTGTCTGAACAGAGAATGCAAGG + Intergenic
915826553 1:159084334-159084356 CTGTGTGAAAGGAGAAGGGAAGG - Intronic
921665262 1:217862391-217862413 CTGAATGAATGGAAATGGAAAGG - Intronic
922620938 1:226987726-226987748 CTGTAAGAAGGGAGGTGGGAGGG + Intergenic
923106997 1:230862081-230862103 CTGGATGAACCAAGATGGCCAGG - Intronic
924307799 1:242709528-242709550 CTGTAAGAATGGAGATGTCATGG - Intergenic
1063922595 10:10947127-10947149 GTGTAAGATCGGAGAAGGCAAGG + Intergenic
1064573144 10:16716531-16716553 ATGTATGGAAGGAGGTGGCAGGG - Intronic
1070988762 10:80712800-80712822 CTGCCTGAACAGAGCTGGCATGG - Intergenic
1072152002 10:92690762-92690784 CTGTATGAACGGAAAGGGTCAGG - Intronic
1082835982 11:57650202-57650224 CTGGAGGAAAGGAGGTGGCAAGG + Intronic
1086520582 11:87663939-87663961 CTGAATGAAAGGAGGTGGGAAGG - Intergenic
1088785205 11:113175305-113175327 CTGTTTGAATGAAGGTGGCAAGG + Intronic
1102639611 12:114355558-114355580 CTCTGTGCACGGAGTTGGCATGG - Exonic
1106582952 13:31033519-31033541 CAGTATTAACAGAGATGGCTAGG + Intergenic
1112646136 13:101334261-101334283 CTGTCTGAACTGTGATAGCAAGG - Intronic
1114733218 14:25016806-25016828 ATGTAGAAAAGGAGATGGCATGG + Intronic
1115190959 14:30746751-30746773 CTGTATGTACTAAGATGGCATGG + Intergenic
1121113468 14:91328170-91328192 CGGAATGAATGGAGATGGCCAGG + Intronic
1121576737 14:94995168-94995190 ATGTGTGAATGGAGATGGGAAGG - Intergenic
1124997262 15:34735911-34735933 CTGTGTGGATGGAGTTGGCAAGG - Intergenic
1125185358 15:36923849-36923871 CTGTATGGAGGGAGGTGACATGG - Intronic
1128502332 15:68235309-68235331 CTGCCTGAACGGAGAGGCCATGG + Intronic
1138188942 16:54998513-54998535 GTGTATGAGGAGAGATGGCAGGG - Intergenic
1141358992 16:83376996-83377018 CTGTATGAACAGAGAGGTCAAGG + Intronic
1141857478 16:86693581-86693603 CTGCATGGAAGGAGATGGGAGGG + Intergenic
1146654961 17:34629727-34629749 CTGTTTAAGAGGAGATGGCAGGG + Intronic
1148103506 17:45107088-45107110 CTGTATGAGCGGAGAGGTGACGG - Exonic
1150278265 17:63913703-63913725 CTGAAAGTAGGGAGATGGCAGGG - Intronic
1150713643 17:67552554-67552576 CTCTAAGAACGAAGATGGAATGG - Intronic
1158119695 18:54035234-54035256 CTGTATAAACAGAGATATCATGG + Intergenic
1159679068 18:71325040-71325062 TTGTATGAAAGGAGATTGAATGG + Intergenic
1162829792 19:13277286-13277308 CAGTATGAAAAGAGATGGGAGGG - Intronic
1163386688 19:17004387-17004409 CTGTGTGAAGAGAGAGGGCAAGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1166933892 19:46319484-46319506 CTGTGTGAAGGGAGGTGCCAGGG + Intronic
925719633 2:6814366-6814388 CTGTTTGAGAAGAGATGGCAAGG + Intergenic
925763453 2:7208640-7208662 CTGTCTGAACCCAGATGGCCAGG - Intergenic
925826963 2:7859031-7859053 CTGTAAGAAGGGAGGTGGTAAGG - Intergenic
926169097 2:10539819-10539841 CTGTATAAACTGGAATGGCAAGG + Intergenic
926414299 2:12633897-12633919 CTGCATGAACAAAGATAGCAAGG + Intergenic
927840649 2:26440870-26440892 CTCTATGAACTGGGATGGAAAGG - Intronic
928031076 2:27779932-27779954 ATGTAATAACAGAGATGGCAAGG + Intronic
929518617 2:42627034-42627056 ATGTATAAAGGGAGATGGCTGGG - Intronic
931164883 2:59735433-59735455 CTGTATGCAAGGGAATGGCATGG + Intergenic
932470796 2:71954556-71954578 CTGTATGAAAGAAAATGTCAAGG - Intergenic
943477643 2:188378611-188378633 CTGCATGAGCAGAGATGGTATGG + Intronic
945283779 2:208061796-208061818 CTGTATGGAAGAAGAAGGCAGGG - Intergenic
947339984 2:229128022-229128044 TTGTGTGCAGGGAGATGGCAGGG + Intronic
1171095472 20:22328652-22328674 CTGTATGAAGGGCTATGGCAAGG - Intergenic
1172897051 20:38307548-38307570 CTGGCTGAAGGGAGAAGGCAGGG - Exonic
1175192066 20:57218033-57218055 CTGTATCCAGGGAGATGGCAAGG + Intronic
1175947997 20:62567648-62567670 CTGTCTGAAAGCAGGTGGCAGGG + Intronic
951081602 3:18456390-18456412 CTGTGTGAACTGAGGAGGCAGGG - Intergenic
952422494 3:33144632-33144654 CTGTGTGAAGGGATCTGGCAGGG + Exonic
952713650 3:36456335-36456357 CTGTTTGTACGGAGATTTCAAGG + Intronic
954410066 3:50366672-50366694 ATGTATGAAAGGTGATGGGAGGG - Intronic
960044704 3:113185652-113185674 CTCCATGAAGGGAGATGTCATGG + Intergenic
960317437 3:116195017-116195039 CTGAATGAACCCAGTTGGCAGGG - Intronic
961332796 3:126153025-126153047 CTCTTTGAACGGCGATGCCATGG - Intronic
966542663 3:181108940-181108962 CTGTATGGGAGGAGATAGCATGG + Intergenic
975124708 4:70768631-70768653 CTGTATGAAAGGAGAAGACTTGG + Exonic
975892742 4:79049003-79049025 CTGAATGGACTGAGTTGGCAGGG + Intergenic
978370957 4:108029228-108029250 CTGTATGAACGGAGATGGCACGG - Intronic
979601119 4:122587574-122587596 CTGACTGGACAGAGATGGCAAGG - Intergenic
984364112 4:178776030-178776052 CTGTGTGAAGGTAGCTGGCATGG + Intergenic
984529305 4:180896382-180896404 CTGTAGGAACCAAAATGGCATGG - Intergenic
985148389 4:186919180-186919202 CTGGATGATGGGAGATGGCCAGG + Intergenic
987347109 5:16988812-16988834 CTCTATGTACAGAGAAGGCATGG + Intergenic
990453506 5:55960453-55960475 CTGTATGAAGGAAGATGGTAAGG - Exonic
994263444 5:97686294-97686316 CTGTAAAAACACAGATGGCAGGG + Intergenic
996627643 5:125588911-125588933 ATGTATGAATGAACATGGCAAGG - Intergenic
997527920 5:134565399-134565421 CTGGATGAAAGGAGAGGGAAGGG + Intronic
1001801215 5:174545855-174545877 CTGTGAGAATGGAGAAGGCAAGG + Intergenic
1007219651 6:40268494-40268516 CAGTGTGAAAGGAGAGGGCAGGG + Intergenic
1007783715 6:44268580-44268602 GTGTGTGAATGGAGAAGGCAGGG + Intergenic
1012310940 6:97723250-97723272 GTGTATGAATGGAGAAGCCATGG + Intergenic
1016192134 6:141282539-141282561 CTGTGTAAAAGGAGATGGGATGG - Intergenic
1016460318 6:144274767-144274789 CTGTATGAATGGGGAAGGCCTGG + Intergenic
1018903019 6:168060566-168060588 CCGGAAGAACAGAGATGGCAGGG - Intronic
1019559618 7:1649461-1649483 CTTTATGAAGGGAGGTGGCCGGG + Intergenic
1021150936 7:17149953-17149975 CTGTAGGAAGTGAGATGGGAGGG - Intergenic
1022886118 7:34645737-34645759 CTGTAGGAAAGGAGAAGGAATGG - Intergenic
1023742324 7:43291976-43291998 CTGAATTAATGGAGAAGGCAGGG - Intronic
1026837223 7:73647267-73647289 CAGAAAGAAGGGAGATGGCAGGG - Intergenic
1028170706 7:87592127-87592149 GTGTGTGAAGGGAGCTGGCAGGG + Intronic
1034861124 7:154595646-154595668 CTGAATGAACCAAGAAGGCAAGG - Intronic
1035914705 8:3606510-3606532 CCCTATGAATGGAGCTGGCAGGG + Intronic
1038731188 8:30129216-30129238 CTTGATGAACAGAGATGGCAAGG - Intronic
1050069671 9:1797615-1797637 CTGTAATAACAGAGAAGGCAAGG + Intergenic
1058793965 9:108478971-108478993 CTGTCAGAACGGAGTTGGTACGG - Intergenic
1059418813 9:114178513-114178535 CTATATGGACAGATATGGCATGG + Intronic
1060177582 9:121508344-121508366 CTGAATGAATGGAAATGGGAGGG + Intergenic
1061540800 9:131277168-131277190 CGGTATCAGCGGAGATGTCACGG - Intergenic
1189018701 X:37311796-37311818 ATGTTTGAACAGAGATGCCAAGG - Intergenic
1189317469 X:40066124-40066146 CTGTATGGACAGGGATGGCTGGG + Intronic
1192510993 X:71720315-71720337 CTGAATGAACGGTTCTGGCATGG + Intergenic
1192515704 X:71761238-71761260 CTGAATGAACGGTTCTGGCATGG - Intergenic
1194062743 X:89224483-89224505 CTGCATGTACGGAGATCACACGG - Intergenic
1197893514 X:131288346-131288368 CTGTAGGAACTGAGATGGAAAGG - Intronic
1200716611 Y:6553462-6553484 CTGCATGTACGGAGATCACACGG - Intergenic
1201268724 Y:12233855-12233877 CTGGATTAACTGGGATGGCATGG + Intergenic
1202101282 Y:21310306-21310328 CTGAATGAACTGAGGTGGAACGG - Intergenic