ID: 978371675

View in Genome Browser
Species Human (GRCh38)
Location 4:108035768-108035790
Sequence TCCTACCCAGGTTCTATGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978371675_978371678 22 Left 978371675 4:108035768-108035790 CCGCACATAGAACCTGGGTAGGA No data
Right 978371678 4:108035813-108035835 AATGCTGCCTAACGAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978371675 Original CRISPR TCCTACCCAGGTTCTATGTG CGG (reversed) Intergenic
No off target data available for this crispr