ID: 978371715

View in Genome Browser
Species Human (GRCh38)
Location 4:108035998-108036020
Sequence GCCCTTGTCCTGGAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978371711_978371715 -9 Left 978371711 4:108035984-108036006 CCCATAGGATGCAGGCCCTTGTC No data
Right 978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG No data
978371712_978371715 -10 Left 978371712 4:108035985-108036007 CCATAGGATGCAGGCCCTTGTCC No data
Right 978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG No data
978371706_978371715 12 Left 978371706 4:108035963-108035985 CCTTACTGTCTCACCAGAGTCCC No data
Right 978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG No data
978371708_978371715 -1 Left 978371708 4:108035976-108035998 CCAGAGTCCCCATAGGATGCAGG No data
Right 978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG No data
978371710_978371715 -8 Left 978371710 4:108035983-108036005 CCCCATAGGATGCAGGCCCTTGT No data
Right 978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978371715 Original CRISPR GCCCTTGTCCTGGAAATGGC AGG Intergenic
No off target data available for this crispr