ID: 978372882

View in Genome Browser
Species Human (GRCh38)
Location 4:108046842-108046864
Sequence CGGTGCAGCTGGGGAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978372882_978372887 -10 Left 978372882 4:108046842-108046864 CCAGCTGTTCCCCAGCTGCACCG No data
Right 978372887 4:108046855-108046877 AGCTGCACCGAAGGTTAGAAAGG No data
978372882_978372892 30 Left 978372882 4:108046842-108046864 CCAGCTGTTCCCCAGCTGCACCG No data
Right 978372892 4:108046895-108046917 TTCAGCAGAGAGGTTTAAGTTGG No data
978372882_978372888 -9 Left 978372882 4:108046842-108046864 CCAGCTGTTCCCCAGCTGCACCG No data
Right 978372888 4:108046856-108046878 GCTGCACCGAAGGTTAGAAAGGG No data
978372882_978372889 -8 Left 978372882 4:108046842-108046864 CCAGCTGTTCCCCAGCTGCACCG No data
Right 978372889 4:108046857-108046879 CTGCACCGAAGGTTAGAAAGGGG No data
978372882_978372891 20 Left 978372882 4:108046842-108046864 CCAGCTGTTCCCCAGCTGCACCG No data
Right 978372891 4:108046885-108046907 GAGCTAGAATTTCAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978372882 Original CRISPR CGGTGCAGCTGGGGAACAGC TGG (reversed) Intergenic
No off target data available for this crispr