ID: 978372939

View in Genome Browser
Species Human (GRCh38)
Location 4:108047265-108047287
Sequence GAGGGTTGCCAGGATTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978372939_978372951 25 Left 978372939 4:108047265-108047287 CCATCTGAATCCTGGCAACCCTC No data
Right 978372951 4:108047313-108047335 CCACCTGGAAAAGGAGGGAGAGG No data
978372939_978372948 19 Left 978372939 4:108047265-108047287 CCATCTGAATCCTGGCAACCCTC No data
Right 978372948 4:108047307-108047329 TTCATACCACCTGGAAAAGGAGG No data
978372939_978372949 20 Left 978372939 4:108047265-108047287 CCATCTGAATCCTGGCAACCCTC No data
Right 978372949 4:108047308-108047330 TCATACCACCTGGAAAAGGAGGG No data
978372939_978372944 10 Left 978372939 4:108047265-108047287 CCATCTGAATCCTGGCAACCCTC No data
Right 978372944 4:108047298-108047320 TGACCCTGTTTCATACCACCTGG No data
978372939_978372947 16 Left 978372939 4:108047265-108047287 CCATCTGAATCCTGGCAACCCTC No data
Right 978372947 4:108047304-108047326 TGTTTCATACCACCTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978372939 Original CRISPR GAGGGTTGCCAGGATTCAGA TGG (reversed) Intergenic
No off target data available for this crispr