ID: 978376261

View in Genome Browser
Species Human (GRCh38)
Location 4:108077721-108077743
Sequence TCCCAGATGGGGCAGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8588
Summary {0: 6, 1: 34, 2: 291, 3: 1900, 4: 6357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978376261_978376269 -1 Left 978376261 4:108077721-108077743 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 978376269 4:108077743-108077765 AAGTGAGGGGCGCCTCTGCCCGG 0: 82
1: 3591
2: 10420
3: 9698
4: 3467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978376261 Original CRISPR TCCCAGATGGGGCAGCAGCC GGG (reversed) Intronic
Too many off-targets to display for this crispr