ID: 978376495

View in Genome Browser
Species Human (GRCh38)
Location 4:108079567-108079589
Sequence CCAGTTGTGTGGGGACCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978376487_978376495 9 Left 978376487 4:108079535-108079557 CCTGAGGTGTTACAATAGCTGGA 0: 1
1: 0
2: 2
3: 8
4: 82
Right 978376495 4:108079567-108079589 CCAGTTGTGTGGGGACCAGGAGG 0: 1
1: 0
2: 2
3: 21
4: 237
978376485_978376495 18 Left 978376485 4:108079526-108079548 CCTGTTTGACCTGAGGTGTTACA 0: 1
1: 0
2: 0
3: 4
4: 99
Right 978376495 4:108079567-108079589 CCAGTTGTGTGGGGACCAGGAGG 0: 1
1: 0
2: 2
3: 21
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978376495 Original CRISPR CCAGTTGTGTGGGGACCAGG AGG Exonic
900526952 1:3134096-3134118 CCAGCTGTGTCGGGAGCAGGAGG + Intronic
902373405 1:16018878-16018900 CCAGCTGTGTGGGGATCAAACGG - Intronic
902411734 1:16215867-16215889 CCGTGTGGGTGGGGACCAGGTGG + Intergenic
902592599 1:17485708-17485730 CCAATGGTGTGGGGAGCAGGTGG + Intergenic
903145421 1:21368918-21368940 GCAGTGATGTGGGCACCAGGAGG + Intergenic
903589216 1:24441547-24441569 GCAGTTGTGTGGGTATCAGTGGG - Intronic
904082037 1:27878242-27878264 CAAGTTGTGTGGGGAGCCGCAGG + Intronic
904341138 1:29835694-29835716 CCCATTAGGTGGGGACCAGGTGG + Intergenic
904744636 1:32703133-32703155 CCTCTTGGGTGGGGACCAGAGGG - Intronic
905248398 1:36630388-36630410 GCAGATGTGGGTGGACCAGGCGG - Intergenic
907356446 1:53878773-53878795 CCAGCTGCGTGGGGTGCAGGAGG + Intronic
907488887 1:54796271-54796293 CCAGCGGGGTGGGGACCTGGCGG - Intronic
907606009 1:55818147-55818169 CCCATTGTGTGGGGCACAGGTGG + Intergenic
907938896 1:59067959-59067981 CTTGCTTTGTGGGGACCAGGAGG + Intergenic
912703674 1:111896515-111896537 CCAGTTCTGTTGGGTCCAGATGG - Intronic
912713938 1:111968739-111968761 CCACATTTCTGGGGACCAGGTGG - Intronic
912812251 1:112803190-112803212 CCAGACGAGTGGGCACCAGGAGG - Intergenic
913044157 1:115059252-115059274 CAGGTTTTGTGGGGAACAGGTGG - Intronic
915168925 1:153964140-153964162 CCAGGTGGGTGGGGACGTGGTGG + Intronic
917600206 1:176566254-176566276 CCAGTCGTTTGGGGTGCAGGTGG + Intronic
920154248 1:203935457-203935479 CCAGATGTTTGGGGTGCAGGTGG + Intergenic
920237300 1:204516583-204516605 CCAGTTGTGCGGGTAGCGGGCGG + Intronic
921190004 1:212700163-212700185 CCGGGGGGGTGGGGACCAGGGGG + Intergenic
922798696 1:228354030-228354052 CCAGCTCTGTGGGGTCCAGATGG - Intronic
923003597 1:230027523-230027545 CCAGTTGTCTGGGAACCATGAGG - Intergenic
923569664 1:235102292-235102314 ACAGCTGTATTGGGACCAGGAGG + Intergenic
924564501 1:245185469-245185491 CAAGTTGTGTTGGGACTAAGTGG + Intronic
1063374631 10:5546676-5546698 CCAGGTGTGTGATGACCATGAGG + Intergenic
1065894044 10:30145775-30145797 CCAGTTGAATGGCGAACAGGAGG - Intergenic
1067722956 10:48743423-48743445 CCACTTGCGTGGGGACCTGAAGG + Exonic
1068644832 10:59454403-59454425 ACAGTTGTGTGAGGATCAAGAGG + Intergenic
1069298958 10:66882953-66882975 CCAGATGTGTGGGCACCATCTGG + Intronic
1069635645 10:69923245-69923267 CCAGATGTGCTGGTACCAGGTGG - Intronic
1069906623 10:71736002-71736024 CCTGCTGTGTGAGGGCCAGGTGG - Intronic
1069907108 10:71738436-71738458 CCAGGTGTTTGGGGCCAAGGAGG + Intronic
1070230355 10:74559249-74559271 CCTGGGTTGTGGGGACCAGGCGG + Intronic
1071576317 10:86729435-86729457 CCACTGGTGTGGGTATCAGGAGG + Intronic
1072979403 10:100087272-100087294 CCAGTTGTGTGGGTATTTGGGGG - Intergenic
1073230778 10:101967729-101967751 TCAGTCGTGGGGGGAGCAGGGGG + Intronic
1074585940 10:114768042-114768064 AGAGGTGAGTGGGGACCAGGTGG - Intergenic
1075663451 10:124214257-124214279 CAAGGTGTTTGGGAACCAGGAGG - Intergenic
1076090393 10:127680626-127680648 CCAGTTAGGTGAGGACCAGATGG + Intergenic
1076368453 10:129936710-129936732 TCAGCTGTGTGGGGACCCAGGGG + Intronic
1076368469 10:129936748-129936770 TCAGCTGTGTGGGGACCCAGGGG + Intronic
1076368485 10:129936786-129936808 TCAGCTGTGTGGGGACCCAGGGG + Intronic
1077210260 11:1367838-1367860 CCAGGGGTGGGGGTACCAGGAGG + Intergenic
1077298791 11:1837959-1837981 CCAGATGTGTGGGGACTGGGAGG - Intergenic
1080858734 11:36134853-36134875 CCGGCTCTCTGGGGACCAGGAGG + Intronic
1081864203 11:46350790-46350812 CCAGTTGTGTGGGGCAGAGATGG - Intronic
1083302465 11:61746133-61746155 CCAGCTGTGTGGGGAGCCGGGGG - Exonic
1083952518 11:65964929-65964951 CCAGGAGTGTGGGGACGAAGTGG + Intronic
1084647051 11:70464724-70464746 CCAGGTGTCTGAGGACCAGATGG + Intergenic
1085016589 11:73177960-73177982 CCAGATGAGAGGGGTCCAGGTGG - Intergenic
1085254325 11:75163944-75163966 ACAGCTGTGGGGGGACCCGGAGG - Exonic
1092848824 12:12608729-12608751 CCAGCGGTAAGGGGACCAGGAGG + Intergenic
1094173080 12:27514753-27514775 CCTGTTGTGTGGGTAACAGATGG + Intergenic
1094793046 12:33936399-33936421 CCAGTTGTGGGGGGGGCAGGGGG + Intergenic
1095584357 12:43834618-43834640 CCAGTGGTGTGGGGATGTGGGGG + Intergenic
1095808397 12:46345957-46345979 CCTGTTGTGTGGGGAAGGGGGGG - Intergenic
1096616878 12:52838282-52838304 CCAGGAGTGTGGGAATCAGGTGG - Intronic
1101239438 12:102823941-102823963 CCAGATGGGTTGGGACCTGGGGG - Intergenic
1101758607 12:107641038-107641060 CCAGCTGGGTGGCGAGCAGGGGG + Intronic
1102486363 12:113260434-113260456 CCAGTTGTGTGCGGGGCTGGAGG - Exonic
1102984807 12:117269423-117269445 CCAGATGTGACGGGCCCAGGGGG + Intronic
1103945012 12:124521089-124521111 CTACATGTGTGGGGCCCAGGGGG + Intronic
1104311526 12:127657816-127657838 CCAGGTGTGGGGAGACGAGGTGG - Intergenic
1104325729 12:127795479-127795501 GGATTTGTGTGGTGACCAGGCGG - Intergenic
1104781189 12:131421653-131421675 CCAGGTGTGTGTGGAGCTGGCGG + Intergenic
1105636784 13:22223288-22223310 CCTGTTCTGTGGGGAGAAGGCGG + Intergenic
1106466720 13:30020187-30020209 CCGTTTGTGTGGGGATGAGGAGG - Intergenic
1106583557 13:31037845-31037867 GCAGGTGAATGGGGACCAGGCGG + Intergenic
1106694514 13:32158347-32158369 CCACTTTTGTGGGGAAAAGGAGG - Intronic
1106832765 13:33602875-33602897 CCAGGGGTTGGGGGACCAGGGGG - Intergenic
1108624083 13:52210660-52210682 CTTGTTGTCTTGGGACCAGGAGG + Intergenic
1108661973 13:52595761-52595783 CTTGTTGTCTTGGGACCAGGAGG - Intergenic
1112390432 13:98978652-98978674 CCAGATGTGTGGGTATCAGAAGG + Intronic
1114459468 14:22877408-22877430 ACTGCTGTGTGGGGTCCAGGGGG - Exonic
1116371755 14:44143562-44143584 CAAGCTGTGTGGGTACCCGGTGG - Intergenic
1119088422 14:71758411-71758433 CCAGTTGCTAGGGGACCAGCAGG - Intergenic
1119939145 14:78622167-78622189 GCAGCTGGGTGGGGAGCAGGGGG - Intronic
1120614049 14:86679775-86679797 CGTGTTGTGAGAGGACCAGGTGG - Intergenic
1120766757 14:88334504-88334526 CCATCTGTGAGGGGAGCAGGTGG - Intergenic
1122901606 14:104784444-104784466 GGGGTTGTGTGGGGCCCAGGAGG - Intronic
1128783937 15:70380842-70380864 CATTTTGTCTGGGGACCAGGAGG - Intergenic
1131510239 15:93045660-93045682 CCAGGAGTGTGTGGACCAGAAGG - Exonic
1132554543 16:566742-566764 CTGGTTGTGGGGGGACCATGGGG + Intergenic
1132802303 16:1760425-1760447 CCAGCTGTCCGGGGAGCAGGAGG + Exonic
1133301898 16:4787674-4787696 CCAGGTGGGTGGGGAGAAGGGGG + Intronic
1133387656 16:5383271-5383293 CCACTGGTGTGGGGAAAAGGTGG + Intergenic
1135735736 16:24930834-24930856 CCAGCTGAGTGGACACCAGGAGG + Exonic
1136685202 16:31989959-31989981 CCAGTTGTGTGGAGGCGGGGAGG + Intergenic
1136706623 16:32194435-32194457 CCAGTTATGTTGGGATCACGTGG + Intergenic
1136761288 16:32734982-32735004 CCAGTTATGTTGGGATCACGTGG - Intergenic
1136785813 16:32933494-32933516 CCAGTTGTGTGGAGGCGGGGAGG + Intergenic
1136806815 16:33135404-33135426 CCAGTTATGTTGGGATCACGTGG + Intergenic
1136883956 16:33920310-33920332 CCAGTTGTGTGGAGGCGGGGAGG - Intergenic
1141627487 16:85268896-85268918 CTACTTGAGGGGGGACCAGGGGG + Intergenic
1141805372 16:86338131-86338153 CCAGGTAAGTGGGGTCCAGGTGG - Intergenic
1142255820 16:89013448-89013470 GAAGCTCTGTGGGGACCAGGAGG + Intergenic
1203063440 16_KI270728v1_random:995299-995321 CCAGTTATGTTGGGATCACGTGG - Intergenic
1203088047 16_KI270728v1_random:1195156-1195178 CCAGTTGTGTGGAGGCGGGGAGG + Intergenic
1143756786 17:9073209-9073231 ACAGGTGTCTGGGGCCCAGGTGG - Intronic
1143830245 17:9645502-9645524 CCAGGTGTGCGGGGACGGGGCGG - Intronic
1144836677 17:18159931-18159953 TCAGCTGTGCGGGGACCATGAGG + Exonic
1146516569 17:33494217-33494239 CCTGTTGTTTGGGGATCAGTAGG + Intronic
1146767882 17:35540420-35540442 ACAGTTTTGGGGGGAACAGGTGG + Intergenic
1147133467 17:38421977-38421999 AGTGATGTGTGGGGACCAGGTGG + Intergenic
1147146145 17:38485640-38485662 CCAGTTGTGTGGAGGCGGGGAGG + Intronic
1147557812 17:41490569-41490591 CCAGTTGTGTGGGGAAGCAGTGG - Intronic
1147598266 17:41730589-41730611 CCAGTAGCCTGGGGACCAGTGGG + Intronic
1148138904 17:45314380-45314402 CCTGGTGTGTGGAGACCAGAGGG + Intronic
1152201885 17:78952199-78952221 CCAGCTGTGTGGGGTGCTGGGGG - Intergenic
1152423312 17:80205476-80205498 CCAGCTGTGTGGGGGTCTGGGGG - Intronic
1153778591 18:8475383-8475405 CAAGAGGTGTGGGGGCCAGGTGG - Intergenic
1154299558 18:13181180-13181202 CCAGTTGTTTGGGGACAGGGTGG - Intergenic
1160185847 18:76675501-76675523 CCAGTTGTACAGGGGCCAGGAGG - Intergenic
1160224385 18:77001117-77001139 CCAGGTGAGTGGGGACCGGGTGG - Intronic
1160970507 19:1765812-1765834 GCAGTGGTGAGGGGAGCAGGGGG + Intronic
1162927492 19:13937720-13937742 CCAGTGGTGAGGGGAGCTGGAGG - Intronic
1163371024 19:16901367-16901389 TCAGCTGTGTGGGCTCCAGGGGG - Intronic
1163710829 19:18845761-18845783 CCAGCTGTGTGGGGGACCGGGGG + Intronic
1164719163 19:30419686-30419708 CCAGCAGTGTGAGGAGCAGGAGG + Intronic
1166781513 19:45345796-45345818 CCAGGTATGAGGGGGCCAGGTGG + Exonic
925825014 2:7839409-7839431 CCAGGTGTCTGGGGAGCATGAGG - Intergenic
926475347 2:13314797-13314819 CCAGTGCTGGGGAGACCAGGAGG - Intergenic
927222648 2:20728309-20728331 ACAGGTCTGTGGGGGCCAGGGGG + Intronic
929050511 2:37832776-37832798 CCAGTGGGGTGGACACCAGGGGG - Intergenic
932141052 2:69278524-69278546 CCAGTTGTGTGGCGTGGAGGAGG - Intergenic
932584964 2:73021974-73021996 CCTGTTCTGTGGAGACCAGGAGG - Intronic
936968580 2:118151901-118151923 CTAGTTCTGTGGGGTCCATGAGG + Intergenic
938452760 2:131437193-131437215 ACACTGGTGAGGGGACCAGGTGG - Intergenic
941022460 2:160423526-160423548 CATGTTGTGTGGGGACAAGTGGG - Intronic
942975997 2:182018574-182018596 TTAGGTGTGTGGGGACCAGAGGG + Intronic
946705017 2:222449788-222449810 CCAGTTATGTGTGTACCAAGGGG + Intronic
947820177 2:233063823-233063845 GGATTTGAGTGGGGACCAGGTGG - Intronic
948574995 2:238944146-238944168 CTTGTTGTCTGGTGACCAGGAGG - Intergenic
948650855 2:239442746-239442768 CCAGTTGTGTGGGGTGGGGGTGG + Intergenic
1170765840 20:19289599-19289621 AGAGGTGTGTTGGGACCAGGAGG - Intronic
1172133699 20:32673298-32673320 CCAGTCTTGAGGGGAGCAGGAGG - Intergenic
1174013920 20:47472634-47472656 CTTTTTGTGTGGGGAGCAGGGGG - Intergenic
1174178076 20:48657448-48657470 CCTGTTGTGTGGGGACACGAGGG + Intronic
1174578310 20:51553280-51553302 GTAGTTGTGCGGGGACCAGGTGG - Intronic
1174985735 20:55449622-55449644 TCAGTTGGGTTGGGAACAGGTGG + Intergenic
1175166008 20:57045267-57045289 CCGGTTGTGTGGGGAGTATGGGG + Intergenic
1175372124 20:58499234-58499256 CCAGTAGTGTGGCCACCAGGAGG - Intronic
1175466626 20:59194079-59194101 ACAGTTGGGGGGGGACAAGGGGG + Exonic
1175791584 20:61743572-61743594 GCAGCTGTGTGGGGACCAAGGGG + Exonic
1176081709 20:63276768-63276790 CAAGTTGTGTGTGGCCCAGTGGG - Intronic
1176137447 20:63530426-63530448 GCAGGTGTGTGGGGACCGGAGGG + Intronic
1177632166 21:23742746-23742768 CCAGTAGTTTGGCGAGCAGGAGG - Intergenic
1177685825 21:24436004-24436026 CCCTTTGTGTGGTGACCATGGGG - Intergenic
1178311076 21:31530617-31530639 CCAGGTGTGTGCCCACCAGGGGG - Intronic
1179044067 21:37829515-37829537 CTGGGTGTGTGGGGGCCAGGGGG + Intronic
1179880330 21:44290909-44290931 CCAGATGGATGGGGAACAGGTGG + Intronic
1180183548 21:46128568-46128590 TCAGTTGCGTGGGGACCAGAGGG + Intronic
1180246661 21:46553021-46553043 CCAGTGTGGTGGGGGCCAGGTGG + Intronic
1181345318 22:22215815-22215837 ACAGTAATGTGGGGCCCAGGAGG - Intergenic
1181807887 22:25386072-25386094 CCTGTTGAGTGAAGACCAGGAGG - Intronic
1182320101 22:29473237-29473259 GCAGCTGTGTGGGGACATGGAGG - Intergenic
1182943081 22:34296864-34296886 CCAGCTGTGTGTGTTCCAGGGGG + Intergenic
1184059092 22:42071039-42071061 CCACCTCTGTGGGGACCAAGAGG + Intergenic
1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG + Intronic
1185213770 22:49587060-49587082 TCAGTGGTGTGAGGATCAGGAGG + Intronic
953184467 3:40625314-40625336 GCACTTGTGTGGGAACCAGTAGG + Intergenic
954378695 3:50208091-50208113 CCTGCTCTGTGGGGACCTGGAGG + Intronic
954758390 3:52855867-52855889 CCAGTTGTCTTGCAACCAGGGGG + Intronic
954797536 3:53169104-53169126 CTTATTGTGTGGGGAGCAGGGGG + Intronic
954943014 3:54392594-54392616 CCAGCTTGGTGAGGACCAGGAGG - Intronic
956660949 3:71596687-71596709 CCAGGTGAGTGGGGACCCTGAGG - Intergenic
956743274 3:72291509-72291531 CCAGGTGTGTGGGGACGGGTGGG - Intergenic
967102908 3:186230841-186230863 CCATCTGGGTGGGGACCTGGTGG + Intronic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
968650929 4:1760021-1760043 CCAGTTTGGTGGGGACCCTGGGG - Intergenic
968974546 4:3814370-3814392 CCAGGTGTGAGGTGGCCAGGGGG - Intergenic
969428334 4:7138714-7138736 ACAGTGGTCTGGGGAGCAGGTGG + Intergenic
970231876 4:13919404-13919426 CCAATTGTGTGGGTCCAAGGTGG - Intergenic
971429417 4:26549098-26549120 ACATTTGTTTGGGGACAAGGAGG + Intergenic
973168223 4:47105390-47105412 CCAGTGGTGTAGGAACAAGGTGG + Intronic
974149006 4:57981514-57981536 CCAGTGGAGTGGGGACAAGCAGG - Intergenic
975469002 4:74743328-74743350 CCAGAAGTGGAGGGACCAGGAGG - Intergenic
978068349 4:104434464-104434486 CTAGGTGTGTGGGGACAATGGGG - Intergenic
978376495 4:108079567-108079589 CCAGTTGTGTGGGGACCAGGAGG + Exonic
982074112 4:151721419-151721441 AAAGATGTGTGGGGAACAGGAGG + Intronic
982923269 4:161303643-161303665 CATGTTGTGGGAGGACCAGGTGG + Intergenic
983314613 4:166115100-166115122 CCAGTTTTGAGGGGGTCAGGAGG - Intergenic
983595737 4:169465311-169465333 CCAGTGGTGGGGGGGACAGGAGG - Intronic
983768468 4:171517884-171517906 CCACTTGCCTGGGGACCAGATGG + Intergenic
986805460 5:11304711-11304733 ACAGTTGTGTCAGGACAAGGTGG - Intronic
989450283 5:41578542-41578564 GCAGTTTTATGGGGAGCAGGAGG + Intergenic
991466977 5:66923790-66923812 CAAGTTGTTTGGGGAGAAGGGGG + Intronic
991504392 5:67308923-67308945 CCAGCTGTGTGTGGCCCTGGAGG - Intergenic
991994793 5:72376321-72376343 CCAGCTGTGATGGGACCATGAGG + Intergenic
993962618 5:94318912-94318934 CAAGCTTTGTGGGGACAAGGAGG - Intronic
994177731 5:96730047-96730069 CCAGGTGTGGGGGGTCCAGGAGG - Intronic
995026903 5:107434316-107434338 ACAGGAGTGTGGGGTCCAGGAGG - Intronic
996425068 5:123305217-123305239 CCAGATGTGTGAGGAGCTGGTGG - Intergenic
998062941 5:139133366-139133388 GCAGATGTTTGGGGAGCAGGTGG + Intronic
998231486 5:140363899-140363921 CCAGGTGGGTAGGGCCCAGGGGG + Exonic
999812462 5:155140582-155140604 CCTGTGGTGTGGGGATGAGGAGG + Intergenic
1001193739 5:169653466-169653488 CCTGTTGTGTGGGCAGCAGCAGG + Intronic
1001445621 5:171780390-171780412 CCAGTTCTCTGAGGGCCAGGTGG + Intergenic
1001690587 5:173629794-173629816 GCAGGTGTGTGGGGAGCAGCAGG - Intergenic
1001778213 5:174345038-174345060 CCAGCTGTGTGGTGAGCAGGTGG - Intergenic
1001881799 5:175251041-175251063 CCAGGGGTGGGGTGACCAGGTGG - Intergenic
1002493864 5:179598907-179598929 CCCTTTGTGTGGGGGCCAGGCGG + Intronic
1002639825 5:180625496-180625518 CCAGCGGGGTGGGGACCTGGGGG - Intronic
1007632353 6:43279527-43279549 CCGGATGAGTGGGGACCATGGGG - Intronic
1007742774 6:44022915-44022937 TGAGTGCTGTGGGGACCAGGGGG - Intergenic
1007842180 6:44725760-44725782 GCAGTTGTGTGGAGAGCAGTAGG + Intergenic
1012996655 6:105981744-105981766 CAAGCTGTTTGGGCACCAGGAGG + Intergenic
1013535088 6:111056627-111056649 CCATTTGTCTGGGGTCAAGGTGG + Intergenic
1017671256 6:156771483-156771505 GGAGTTGTATGGGGACCAGAGGG - Intergenic
1019779585 7:2931424-2931446 ACAGAGGTGTGGAGACCAGGAGG - Intronic
1021809467 7:24389445-24389467 CCAATTGTGTTGGGAGAAGGGGG - Intergenic
1023990452 7:45125465-45125487 GCAGTTGTGTGGGCACTAAGAGG + Intergenic
1027247441 7:76376736-76376758 GCAGTGGCGTGGGGACAAGGTGG - Intergenic
1028975515 7:96908820-96908842 ACTGTTGTCTGGGGACCAGTAGG - Intergenic
1029217208 7:98959189-98959211 CCAGCTGTGTGGAGGTCAGGCGG + Intronic
1029697704 7:102225063-102225085 CCAGTTCTCTGGTGACCCGGGGG + Intronic
1032839135 7:135700333-135700355 CCAGGTGTGAAGGGAACAGGAGG - Intronic
1033400664 7:141021100-141021122 GTAGTTTTGTGGGGAACAGGTGG + Intergenic
1033579061 7:142715344-142715366 CCAGTTCTGGGGGCTCCAGGTGG - Intergenic
1034186293 7:149179691-149179713 CCAGTTATGAGGGGACCTGGTGG - Exonic
1035529596 8:340570-340592 TCCGTTGTGTGTGGACCAGAAGG + Intergenic
1035756169 8:2034538-2034560 CCAGTCTTGTGAGGAGCAGGAGG - Intergenic
1037960849 8:23097143-23097165 CTAGTTGTGGGGGGACCAGGAGG - Intronic
1038418674 8:27417855-27417877 CCAGTGGTGGGGGCTCCAGGAGG + Intronic
1043045299 8:75315404-75315426 GCAGCTGTGTGGGGACCCTGGGG + Intergenic
1046200986 8:110927307-110927329 GGAGTTGTGTGGGGCCCAGCAGG + Intergenic
1047191340 8:122681630-122681652 CCAGGTCTCTGGGCACCAGGAGG - Intergenic
1048289541 8:133170002-133170024 ACAGTTGTATGGGGAACGGGGGG + Intergenic
1048655210 8:136528575-136528597 CCAGTTGTTTGGAGAGAAGGTGG - Intergenic
1048823683 8:138402405-138402427 CCAGGTGTGTAAGGACCAGATGG + Intronic
1048981269 8:139704261-139704283 CCAGCTGGCTGGGGACCAGGCGG - Intergenic
1049106511 8:140617076-140617098 CAAGGTGTGTGGGGATGAGGGGG - Intronic
1049197163 8:141322246-141322268 GGAGTTGAGTGGGGAGCAGGGGG - Intergenic
1049340446 8:142109541-142109563 CCAGCTGCCTGGGGACCAGGAGG - Intergenic
1049528464 8:143141720-143141742 CGCGCTGTGTGGGGACCAGAGGG - Intergenic
1049758617 8:144321809-144321831 CCAGCACTGTGGGGACCAAGTGG + Intronic
1049777185 8:144412196-144412218 CCGGGTGTGTGGGCAGCAGGTGG - Intronic
1051596531 9:18829847-18829869 CCAACTGTGTGGGGACTTGGGGG - Exonic
1051899555 9:22024407-22024429 GCATTTTTGTGGGGAACAGGAGG + Intronic
1053758416 9:41332784-41332806 CCAGCTGTGTGAGGCCCTGGGGG + Intergenic
1055401840 9:75932494-75932516 CCAGTTGCGTGGGGACCAAGAGG + Intronic
1055484521 9:76744641-76744663 CCCATTGTGTGGGGAACATGTGG - Intronic
1057252954 9:93518754-93518776 CCTGTGGTGTGAGGACCAGCAGG + Intronic
1060666245 9:125433677-125433699 CCAGAGGTGTGGCGGCCAGGGGG - Intergenic
1060666660 9:125435924-125435946 TCAGCTGTGTGGGGACCACAGGG - Intergenic
1060847420 9:126848461-126848483 CTAGTTCTGTGAGGACCAGAGGG + Intergenic
1061451305 9:130668332-130668354 ACTGTTGTGTAGGGACCAGCCGG + Intronic
1186980903 X:14956411-14956433 CCTGTTGTGGGAGGACCTGGTGG - Intergenic
1188450720 X:30306263-30306285 CCACTTGGGTGGGGAGAAGGTGG - Intronic
1190520273 X:51272154-51272176 CCAGATGTGTGTGGAGCAGGAGG + Intergenic
1194314684 X:92361824-92361846 CCAGTGGCTTGGGTACCAGGAGG - Intronic
1194975981 X:100396419-100396441 CCACTTGTTTTGGGTCCAGGTGG - Intronic
1196811102 X:119629573-119629595 CCAGGTGGGTGGGGACCAGTAGG + Intronic
1200002094 X:153067406-153067428 CTTGTTGTGTGTGGACCGGGTGG - Intergenic
1200005639 X:153082619-153082641 CTTGTTGTGTGTGGACCGGGTGG + Intergenic
1200061661 X:153486442-153486464 CGAGTTGGGAGGGGGCCAGGAGG + Intronic
1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG + Intronic
1200622739 Y:5473341-5473363 CCAGTGGCTTGGGTACCAGGAGG - Intronic