ID: 978382170

View in Genome Browser
Species Human (GRCh38)
Location 4:108140639-108140661
Sequence CTTTCCCCTCACCCGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978382168_978382170 3 Left 978382168 4:108140613-108140635 CCATCTAGGTTTTCATCTTATTT 0: 1
1: 0
2: 6
3: 46
4: 577
Right 978382170 4:108140639-108140661 CTTTCCCCTCACCCGGAGTCAGG No data
978382166_978382170 18 Left 978382166 4:108140598-108140620 CCATTTTATAATCAGCCATCTAG 0: 1
1: 0
2: 1
3: 21
4: 198
Right 978382170 4:108140639-108140661 CTTTCCCCTCACCCGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978382170 Original CRISPR CTTTCCCCTCACCCGGAGTC AGG Intronic
No off target data available for this crispr