ID: 978385549

View in Genome Browser
Species Human (GRCh38)
Location 4:108172751-108172773
Sequence TCCGGGGCGCGGCTGTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978385543_978385549 -3 Left 978385543 4:108172731-108172753 CCTGCCTCGCTGGGTGGGGGTCC No data
Right 978385549 4:108172751-108172773 TCCGGGGCGCGGCTGTCCACAGG No data
978385533_978385549 11 Left 978385533 4:108172717-108172739 CCGAGCCCTGCGTCCCTGCCTCG No data
Right 978385549 4:108172751-108172773 TCCGGGGCGCGGCTGTCCACAGG No data
978385542_978385549 -2 Left 978385542 4:108172730-108172752 CCCTGCCTCGCTGGGTGGGGGTC No data
Right 978385549 4:108172751-108172773 TCCGGGGCGCGGCTGTCCACAGG No data
978385537_978385549 5 Left 978385537 4:108172723-108172745 CCTGCGTCCCTGCCTCGCTGGGT No data
Right 978385549 4:108172751-108172773 TCCGGGGCGCGGCTGTCCACAGG No data
978385546_978385549 -7 Left 978385546 4:108172735-108172757 CCTCGCTGGGTGGGGGTCCGGGG No data
Right 978385549 4:108172751-108172773 TCCGGGGCGCGGCTGTCCACAGG No data
978385535_978385549 6 Left 978385535 4:108172722-108172744 CCCTGCGTCCCTGCCTCGCTGGG No data
Right 978385549 4:108172751-108172773 TCCGGGGCGCGGCTGTCCACAGG No data
978385532_978385549 21 Left 978385532 4:108172707-108172729 CCAGTGCAGGCCGAGCCCTGCGT No data
Right 978385549 4:108172751-108172773 TCCGGGGCGCGGCTGTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978385549 Original CRISPR TCCGGGGCGCGGCTGTCCAC AGG Intergenic
No off target data available for this crispr