ID: 978385647

View in Genome Browser
Species Human (GRCh38)
Location 4:108173151-108173173
Sequence CAGGCGCCTGAACTTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978385643_978385647 -3 Left 978385643 4:108173131-108173153 CCTTTCTGAAAAACTTTTCTCAG No data
Right 978385647 4:108173151-108173173 CAGGCGCCTGAACTTGGCATGGG No data
978385642_978385647 0 Left 978385642 4:108173128-108173150 CCTCCTTTCTGAAAAACTTTTCT No data
Right 978385647 4:108173151-108173173 CAGGCGCCTGAACTTGGCATGGG No data
978385641_978385647 1 Left 978385641 4:108173127-108173149 CCCTCCTTTCTGAAAAACTTTTC No data
Right 978385647 4:108173151-108173173 CAGGCGCCTGAACTTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978385647 Original CRISPR CAGGCGCCTGAACTTGGCAT GGG Intergenic
No off target data available for this crispr