ID: 978387687

View in Genome Browser
Species Human (GRCh38)
Location 4:108192279-108192301
Sequence AGCTCTATGTTTCCCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978387687_978387694 7 Left 978387687 4:108192279-108192301 CCACCTCAGGGAAACATAGAGCT No data
Right 978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG No data
978387687_978387691 -1 Left 978387687 4:108192279-108192301 CCACCTCAGGGAAACATAGAGCT No data
Right 978387691 4:108192301-108192323 TGTTCTCACCCTCTGGGCAGAGG No data
978387687_978387689 -8 Left 978387687 4:108192279-108192301 CCACCTCAGGGAAACATAGAGCT No data
Right 978387689 4:108192294-108192316 ATAGAGCTGTTCTCACCCTCTGG No data
978387687_978387696 28 Left 978387687 4:108192279-108192301 CCACCTCAGGGAAACATAGAGCT No data
Right 978387696 4:108192330-108192352 GGCCAGCAGAAAAGTGTGAGTGG No data
978387687_978387692 0 Left 978387687 4:108192279-108192301 CCACCTCAGGGAAACATAGAGCT No data
Right 978387692 4:108192302-108192324 GTTCTCACCCTCTGGGCAGAGGG No data
978387687_978387690 -7 Left 978387687 4:108192279-108192301 CCACCTCAGGGAAACATAGAGCT No data
Right 978387690 4:108192295-108192317 TAGAGCTGTTCTCACCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978387687 Original CRISPR AGCTCTATGTTTCCCTGAGG TGG (reversed) Intergenic
No off target data available for this crispr