ID: 978387688

View in Genome Browser
Species Human (GRCh38)
Location 4:108192282-108192304
Sequence AACAGCTCTATGTTTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978387688_978387690 -10 Left 978387688 4:108192282-108192304 CCTCAGGGAAACATAGAGCTGTT No data
Right 978387690 4:108192295-108192317 TAGAGCTGTTCTCACCCTCTGGG No data
978387688_978387692 -3 Left 978387688 4:108192282-108192304 CCTCAGGGAAACATAGAGCTGTT No data
Right 978387692 4:108192302-108192324 GTTCTCACCCTCTGGGCAGAGGG No data
978387688_978387694 4 Left 978387688 4:108192282-108192304 CCTCAGGGAAACATAGAGCTGTT No data
Right 978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG No data
978387688_978387696 25 Left 978387688 4:108192282-108192304 CCTCAGGGAAACATAGAGCTGTT No data
Right 978387696 4:108192330-108192352 GGCCAGCAGAAAAGTGTGAGTGG No data
978387688_978387691 -4 Left 978387688 4:108192282-108192304 CCTCAGGGAAACATAGAGCTGTT No data
Right 978387691 4:108192301-108192323 TGTTCTCACCCTCTGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978387688 Original CRISPR AACAGCTCTATGTTTCCCTG AGG (reversed) Intergenic
No off target data available for this crispr