ID: 978387694

View in Genome Browser
Species Human (GRCh38)
Location 4:108192309-108192331
Sequence CCCTCTGGGCAGAGGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978387687_978387694 7 Left 978387687 4:108192279-108192301 CCACCTCAGGGAAACATAGAGCT No data
Right 978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG No data
978387688_978387694 4 Left 978387688 4:108192282-108192304 CCTCAGGGAAACATAGAGCTGTT No data
Right 978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978387694 Original CRISPR CCCTCTGGGCAGAGGGAATC AGG Intergenic
No off target data available for this crispr