ID: 978387814

View in Genome Browser
Species Human (GRCh38)
Location 4:108193187-108193209
Sequence AACAGCAATCTGACCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978387814_978387819 27 Left 978387814 4:108193187-108193209 CCAAATTTGGTCAGATTGCTGTT No data
Right 978387819 4:108193237-108193259 AACATTACTTTTTACAATTCAGG No data
978387814_978387817 -10 Left 978387814 4:108193187-108193209 CCAAATTTGGTCAGATTGCTGTT No data
Right 978387817 4:108193200-108193222 GATTGCTGTTGGGAAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978387814 Original CRISPR AACAGCAATCTGACCAAATT TGG (reversed) Intergenic
No off target data available for this crispr