ID: 978390582

View in Genome Browser
Species Human (GRCh38)
Location 4:108221114-108221136
Sequence TGATAATTATAAAACTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978390579_978390582 -2 Left 978390579 4:108221093-108221115 CCTGAAATTCATAGTCAGTGTTG No data
Right 978390582 4:108221114-108221136 TGATAATTATAAAACTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978390582 Original CRISPR TGATAATTATAAAACTTGGG TGG Intergenic
No off target data available for this crispr