ID: 978398203

View in Genome Browser
Species Human (GRCh38)
Location 4:108305063-108305085
Sequence GAACAGATCGAGACCGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978398203_978398205 -10 Left 978398203 4:108305063-108305085 CCATCCACGGTCTCGATCTGTTC No data
Right 978398205 4:108305076-108305098 CGATCTGTTCCACCACCGTCTGG No data
978398203_978398211 26 Left 978398203 4:108305063-108305085 CCATCCACGGTCTCGATCTGTTC No data
Right 978398211 4:108305112-108305134 CCAGTTTCCTTTCCCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978398203 Original CRISPR GAACAGATCGAGACCGTGGA TGG (reversed) Intergenic
No off target data available for this crispr